Canadian Journal of Plant Pathology

ISSN: 0706-0661 (Print) 1715-2992 (Online) Journal homepage: www.tandfonline.com/journals/tcjp20

Root and crown rot pathogens causing wilt

symptoms on field-grown marijuana (Cannabis
sativa L.) plants

Zamir K. Punja, Cameron Scott & Sarah Chen

To cite this article: Zamir K. Punja, Cameron Scott & Sarah Chen (2018) Root and crown
rot pathogens causing wilt symptoms on field-grown marijuana (Cannabis sativa L.) plants,
Canadian Journal of Plant Pathology, 40:4, 528-541, DOI: 10.1080/07060661.2018.1535470

To link to this article: https://doi.org/10.1080/07060661.2018.1535470

© 2018 The Author(s). Published by Informa

UK Limited, trading as Taylor & Francis
Group.

Published online: 16 Nov 2018.

Submit your article to this journal

Article views: 6549

View related articles

View Crossmark data

Citing articles: 6 View citing articles

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=tcjp20
Can. J. Plant Pathol., 2018
Vol. 40, No. 4, 528–541, https://doi.org/10.1080/07060661.2018.1535470

Epidemiology/Épidémiologie

Root and crown rot pathogens causing wilt symptoms on

field-grown marijuana (Cannabis sativa L.) plants

ZAMIR K. PUNJA, CAMERON SCOTT AND SARAH CHEN

Department of Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC V5A 1S6, Canada

(Accepted 19 September 2018)

Abstract: Yellowing and wilting symptoms on field-grown Cannabis sativa (cannabis) plants followed by total plant collapse under conditions of
extreme hot weather were observed in northern California in 2017. The crown regions of affected plants were dark and sunken and internal tissue
discolouration extended 10–15 cm above the soil surface. Isolations made from the pith, vascular and cortical tissues in the crown region yielded
Fusarium oxysporum (40% frequency), F. brachygibbosum (28% frequency), Pythium aphanidermatum (22% frequency), Fusarium solani and F.
equiseti (5% frequency each). Pathogenicity tests were conducted on rooted plantlets to establish the extent of root and crown decay, as well as on
mature stems to determine the extent of stem tissue colonization caused by these species. Extensive reduction in root length was caused by F. solani, F.
oxysporum, F. brachygibbosum and P. aphanidermatum and wounding significantly enhanced disease development. Stem tissue colonization by these
pathogens at wound sites was similarly extensive. Isolates of F. equiseti were non-pathogenic. Both F. solani and P. aphanidermatum caused plant
mortality within 6–10 weeks following inoculation. In phylogenetic analyses using the internal transcribed spacer (ITS) rDNA region and the
elongation factor 1 (EF-1α) region, F. oxysporum isolates from cannabis plants in northern California were grouped separately from all other formae
speciales and from isolates previously recovered from British Columbia. Two isolates of F. brachygibbosum were identical to an isolate previously
reported to infect almond stems in cold storage and field-grown seedlings in northern California. These findings indicate that a complex of pathogens
potentially can cause root and crown rot under field conditions, resulting in wilt symptoms and collapse of cannabis plants.

Keywords: crown rot, fusarium root rot, pythium root rot, stem colonization, wilting

Résumé: En 2017, des symptômes du jaunissement et du flétrissement constatés sur le cannabis (Cannabis sativa) cultivé en champ, suivi de
l’effondrement complet de la plante dans des conditions de temps extrêmement chaud, ont été observés dans le nord de la Californie. La
région du collet des plants touchés était sombre et enfoncée, et la décoloration du tissu interne s’étendait de 10 à 15 cm au-dessus de la
surface du sol. Les isolements faits à partir de la moelle ainsi que des tissus vasculaires et corticaux provenant de la région du collet ont
produit Fusarium oxysporum (fréquence de 40%), F. brachygibbosum (fréquence de 28%), Pythium aphanidermatum (fréquence de 22%),
Fusarium solani et F. equiseti (fréquence de 5% chacun). Des tests de pathogénicité ont été menés sur des plantules enracinées afin d’établir
l’ampleur de la pourriture des racines et du collet causée par ces espèces, ainsi que sur des tiges matures pour déterminer l’importance de la
colonisation des tissus de la tige. F. solani, F. oxysporum, F. brachygibbosum et P. aphanidermatum ont considérablement réduit la longueur
des racines, et les lésions ont notablement accru le développement des maladies. La colonisation des tissus de la tige par ces agents
pathogènes aux sites des lésions était tout aussi considérable. Les isolats de F. equiseti n’étaient pas pathogènes. F. solani et P.
aphanidermatum ont causé la mort des plants en 6 à 10 semaines suivant l’inoculation. Dans le cadre des analyses phylogénétiques basées
sur la région de l’espaceur transcrit interne (ITS) de l’ADNr et la région du facteur d’élongation 1 (EF-1α), les isolats de F. oxysporum
provenant de plants de cannabis du nord de la Californie ont été regroupés séparément de toutes les autres formae speciales, ainsi que des
isolats préalablement récupérés de Colombie-Britannique. Deux isolats de F. brachygibbosum étaient identiques à un isolat qui, auparavant,

Correspondence to: Zamir K. Punja. E-mail: [email protected]

All editorial decisions on this manuscript were made by Pervaiz A. Abbasi

© 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/licenses/by-nc-
nd/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited, and is not altered, transformed, or built
upon in any way.

Published online 16 Nov 2018

Root and crown rot pathogens on field-grown marijuana 529

avait infecté des tiges d’amandier entreposées en chambre froide et des semis cultivés en champ dans le nord de la Californie. Ces résultats
indiquent qu’un complexe d’agents pathogènes peut causer la pourriture des racines et du collet dans des conditions réelles, provoquant des
symptômes de flétrissement et d’effondrement chez les plants de cannabis.

Mots clés: colonisation de la tige, flétrissement, pourridié pythien, pourriture du collet, pourridié fusarien

The objective of this study was to isolate, characterize

Introduction and identify the potential causal agent(s) associated with
the wilting symptoms on the affected cannabis plants in
Cannabis sativa L., a member of the family Cannabeaceae, outdoor production, and to confirm pathogenicity of any
is grown as a source of fibre and seed (as industrial hemp) or recovered isolates.
for medicinal and recreational use (as marijuana or cannabis)
in Canada and the USA. For commercial production in
Canada, hemp is grown outdoors (Laate, 2012) while can- Materials and methods
nabis is presently grown primarily indoors under greenhouse
conditions or in controlled environment rooms (Punja & Plant samples
Rodriguez, 2018) by licensed producers. Cannabis produc- A number of affected cannabis plants showing symp-
tion in the USA, in states where it has been approved by the toms of yellowing, wilting and collapse (Fig. 1) were
state legislature for the purposes of medicinal or recreational sampled from a production field in northern California in
use, occurs both indoors and outdoors. As of January 2018, September 2017. The cannabis strains observed to be
nine USA states allow the legal sale and possession of most affected by crown and root disease in this field
marijuana for both medical and recreational use, while were ‘Agent Orange’ and ‘Maui Dawg’ (A. Abare, per-
Vermont and the District of Columbia have legalized perso- sonal communication) and represented about 4–5% of
nal use but not commercial sale (Anonymous, 2017). In the total plant population. The plants had been initiated
addition, 31 US states and the District of Columbia have from stem cuttings grown in 4 L pots in an outdoor
passed state laws allowing some degree of medical use of nursery and then transplanted into raised fabric pots
marijuana. Legislative approval for recreational use of can- (Grassroots; www.cannabisfabricpots.com) which con-
nabis in Canada has been granted and policies will be tained a mixture of pasteurized soil, vermiculite, vermi-
enforced in all provinces in October 2018. composted plant materials and a blend of fertilizer and
California is the largest producer in the USA of both were provided with drip irrigation. From a total of six
medical and recreational marijuana, with both indoor and symptomatic plants, approximately 20 tissue samples
outdoor production (Gettman, 2006). In August– were collected. Each tissue sample was comprised of
September 2017, cannabis plants cultivated by a licensed either outer bark and cortical tissues taken from sunken
producer in a field located in northern California dis- dark areas near the crown of the plants (10 samples)
played symptoms of yellowing and wilting in compar- (Fig. 2) or internal discoloured areas extending
ison to unaffected plants (Fig. 1). During conditions of 10–15 cm upward from the crown that included the
extreme hot weather (exceeding 35°C during the daytime pith and vascular tissues (10 samples). Samples were
for several weeks during July–September), plants had placed in individual sealed plastic bags and stored at 4°
completely collapsed (Fig. 1). Previously reported patho- C for 7–10 days until isolations were made. Small seg-
gens that could potentially cause wilting and collapse of ments of tissue (5 mm2) were cut from the samples,
C. sativa plants grown outdoors include Fusarium oxy- dipped into a 0.5% NaOCl solution for 30 s followed
sporum f. sp. cannabis and F.o. f. sp. vasinfectum by 20 s in 70% EtOH, rinsed thrice in sterile water, and
(McPartland, 1996, 2004). A recent report showed that blotted dry on sterile paper towels. The tissue pieces
Pythium aphanidermatum (Edson) Fitzp. also caused were cut into smaller pieces (2–3 mm2) and plated onto
stunting and wilting and occasional death of industrial potato dextrose agar (PDA, Sigma Chemicals, St Louis,
hemp plants (Beckerman et al., 2017), and has been MO) amended with 100 mg L−1 streptomycin sulphate
recovered also from greenhouse-grown rooted cannabis and incubated at ambient temperature (23 ± 2°C) for
cuttings and flowering plants (Punja & Rodriguez, 5–7 days. Subcultures were made from the growing
2018). In indoor hydroponic cultivation, F. oxysporum margins of colonies and transferred to fresh PDA for
and F. solani were shown to cause root rot and wilt of subsequent identification to genus level using morpholo-
cannabis plants (Punja & Rodriguez, 2018). gical criteria (Van der Plaats-Niterink, 1981; Leslie &
Z. K. Punja et al. 530

Fig. 1 (Colour online) Symptoms of root and crown rot on field-grown cannabis plants. (A) A healthy cannabis plant of approximately
16 weeks of age in full flower; (B) Early symptoms of general yellowing of the foliage on a diseased plant; (C) Pronounced yellowing of a
diseased plant; (D) Rapid wilting of diseased plant under hot weather conditions; (E) Death and desiccation of diseased plant; (F) Dark
sunken area at the crown extending up to 15 cm from the soil surface.
Root and crown rot pathogens on field-grown marijuana 531

Fig. 2 (Colour online) Symptoms of root and crown rot on field-grown cannabis plants. (A) Crown region of diseased plant showing a
darkening of the underlying tissues extending into the roots below the soil surface; (B) Superficial mycelial growth on sunken areas at the
crown; (C, D) Dark staining and rot of the underlying tissues progressing upwards from the crown; (E) Reddish-brown internal decay
originating from the crown and root zone and extending upwards; (F) Colonies of Pythium and Fusarium originating from diseased tissues –
top row: P. aphanidermatum (far left) and Fusarium oxysporum CA-1 and CA-2 (middle and right Petri dishes); bottom row: F.
brachygibbosum (far left), F. equiseti (middle dish), F. solani (far right). Isolates of these species (except F. equiseti) originated from
outer bark, cortical and vascular tissues; isolates of F. equiseti originated from the bark only.

Summerell, 2006) Hyphal tip sub-cultures were made of following protocol. Cultures of representative isolates from
representative isolates (a total of 40) and stored on PDA cannabis tissues were grown in potato dextrose broth at
slants at 4°C for subsequent identification to species room temperature for 7 days and DNA was extracted from
level using PCR. harvested mycelium using the QIAGEN DNeasy Plant
Mini Kit. Aliquots of 1 uL containing 5–20 ng DNA were
used for PCR in a 25 uL reaction volume consisting of 2.5
Identification of isolates by PCR
uL 10× buffer (containing 15 mM MgCl2), 0.5 uL 10 mM
Cultures tentatively identified using morphological criteria dNTP, 0.25 uL Taq DNA Polymerase (QIAGEN), 0.25 uL
(Van der Plaats-Niterink, 1981; Leslie & Summerell, 2006) 10 mM forward and reverse primers, as well as 20.25 uL
as Pythium and Fusarium spp. that originated from dis- DNAse- and RNAse-free water (Invitrogen). All PCR
eased plants were sent to the University of Guelph amplifications were performed in a MyCycler thermocy-
Laboratory Services, Agriculture and Food Laboratory, cler (BIORAD) with the following program: 3 min at 94°C;
Guelph, ON (www.guelphlabservices.com) for species 30 s at 94°C, 30 s at 60oC, 3 min at 72oC (35 cycles); and
identification by PCR using the primers ITS1–ITS4 7 min at 72oC. PCR products were separated on 1% agarose
(ITS1-F CTTGGTCATTTAGAGGAAGTAA and ITS4 gels and bands of the expected size (~700 bp) were purified
TCCTCCGCTTATTGATATGC). In addition, for with QIAquick Gel Extraction Kit and sent to Eurofins
Fusarium spp., the elongation factor 1α (EF-1 α) primer Genomics (Eurofins MWG Operon LLC 2016,
set EF-1 (5ʹ ATG GGT AAG GAG GAC AAG AC 3ʹ) and Louisville, KY) for sequencing. The ITS1-5.8S-ITS2 or
EF-2 (5ʹ GGA GGT ACC AGT GAT CAT GTT 3ʹ) EF-1α sequences were compared to the corresponding
(O’Donnell et al., 1998) was also used according to the sequences from the National Center for Biotechnology
Z. K. Punja et al. 532

Fig. 3 Phylogenetic tree of Fusarium oxysporum isolates originating from cannabis plants using (A) ITS1-5.8S-ITS2 sequences and (B) EF-
1α sequences compared to isolates from a range of other hosts (GenBank numbers are shown). A bootstrap consensus tree was inferred from
1000 replicates to represent the distance using the neighbour-joining (NJ) method. Branches corresponding to partitions reproduced in less
than 50% bootstrap replicates were collapsed. Isolates BC-1 and BC-2 were from British Columbia obtained in a previous study (Punja &
Rodriguez, 2018) and CA-1 and CA-2 were from California (present study). The scale bar indicates the expected number of nucleotide
substitutions.

Information (NCBI) GenBank database. Multiple sequence partitions reproduced in less than 50% bootstrap replicates
alignment of the respective isolates of each species was were collapsed (Felsenstein, 1985).
done using the CLUSTAL W program (http://www.gen
ome.jp/tools/clustalw). The consensus sequences of
Fusarium species were subsequently included in a phylo- Pathogenicity tests
genetic analysis using the neighbour-joining (NJ) method Rooted cuttings. Stem cuttings (~15 cm in length) of can-
(Saitou & Nei, 1987; Tamura et al., 2004) in the software nabis strain ‘CBD Therapy’ were rooted by inserting them
MEGA v. 5 (Tamura et al., 2011). A bootstrap consensus into 5 cm2 rockwool plugs that had been pre-soaked in
tree was inferred from 1000 replicates. Sclerotinia sclero- hydroponic nutrient solution (Current Culture H2O®)
tiorum was used as an outgroup. Branches corresponding to (https://www.cch2o.com/). The cuttings were misted with a
Root and crown rot pathogens on field-grown marijuana 533

Fig. 3 Continued.

hand atomizer and covered with a plastic dome to maintain dextrose broth in 125 mL Erlenmeyer flasks and incubating
high humidity and placed on the laboratory bench at ambient on a shaker at 100 rpm for 7 days under ambient conditions.
room temperature (22–25°C) with a 16-h photoperiod. The contents were transferred to 150 mL of water and
Misting was repeated every other day. Once rooted (about blended in a Waring blender at high speed for 10 s. The
2 weeks later), the rockwool plugs were transferred to 8 cm2 suspension, which consisted of mycelium of Pythium or
pots containing a 1:4 mix of vermiculite:coconut fibre Fusarium, as well as spores in the case of Fusarium, was
(Canna Coco brick) (http://www.cannagardening.ca/coco_ serially diluted (in 10-fold increments) and 0.5 mL aliquots
brick) and placed in a plastic tray containing tap water. The were spread onto a series of Petri dishes containing PDA and
plants were grown under Sunblaster brand CFL lamps (200 placed at 23–25°C for 5 days to estimate colony-forming
watts, 24 h photoperiod, light intensity of 240 umol m−2 s−1), units per mL. Avolume of 20 mL of inoculum of each isolate
temperature range of 21–25°C. After 2 weeks, the plants was poured into the pot containing the plant, and a scalpel
were inoculated with two isolates of each of the previously was inserted vertically at the base of the plant into the soil at
identified Pythium or Fusarium species. The inoculum was four locations to create wounds. Control plants were simi-
prepared by transferring a mycelial plug into 75 mL of potato larly wounded and received 20 mL of sterile water. Non-
Z. K. Punja et al. 534

Fig. 4 Phylogenetic tree of F. brachygibbosum isolates originating from cannabis plants using (A) ITS1-5.8S-ITS2 sequences and (B) EF-1α
sequences compared to isolates from a range of other hosts (GenBank numbers are shown). A bootstrap consensus tree was inferred from
1000 replicates using the neighbour-joining (NJ) method. Branches corresponding to partitions reproduced in less than 50% bootstrap
replicates were collapsed. Isolates BC-1 and BC-2 of F. oxysporum and F. solani were from British Columbia obtained in a previous study
(Punja & Rodriguez, 2018) and isolates FB-1 and FB-2 of F. brachygibbosum and F. oxysporum CA-1 and CA-2 were from California
(present study). The F. brachygibbosum isolates were grouped with a canker-causing isolate from almond seedlings in California (GenBank
KX421379.1). The scale bar indicates the expected number of nucleotide substitutions.

wounded inoculated plants were also included. There were Stem tissues. Mature cannabis plants (12–14 weeks
four replicate plants per isolate. After 5 weeks, all plants were old) were harvested and side branches (3–6 mm in
examined for foliar symptoms (leaf chlorosis or necrosis, diameter) were cut into sections 15 cm in length and
stunted growth) and depotted, and the extent of root brown- brought back to the laboratory. The surfaces of the
ing and root length was compared to the non-inoculated stem and cut edges were wiped with tissue paper
control plants. The root length measurements were expressed dipped in a 70% EtOH solution and placed inside a
as means ± standard errors. Root, crown and lower stem plastic box. Using a scalpel, a 6 cm long strip of the
segments ~1 cm long were surface-sterilized for 30 s in a stem surface (including the bark and epidermal tis-
0.5% NaOCl solution, rinsed three times for 30 s in sterile sues) was removed, or a 0.3 × 0.3 cm piece was cut
water, blotted dry on a sterile paper towel and then plated on and removed to expose the underlying tissue. The
PDA. Plates were incubated at room temperature (22 ± 3°C) wounded stems were inoculated with a 0.5 cm dia-
for three days. The experiment was conducted twice. meter mycelial plug taken from a 7 day-old PDA
Root and crown rot pathogens on field-grown marijuana 535

Fig. 4 Continued.

culture of the isolate to be tested, and placed mycelial There were five replicate stems per isolate and the
side down on the exposed tissues. The stems were experiment was conducted twice. Rating measure-
carefully transferred into test-tubes (150 × 20 mm) ments were expressed as means ± standard errors.
containing a moistened cotton plug placed on the
bottom and sealed with a cap and stored horizontally
in a test-tube rack at ambient conditions (temperature Results and discussion
range 22–25°C). Controls included non-inoculated
Field symptoms
stems and inoculated non-wounded stems. The extent
of browning of the stems and colonization by mycelial At the time of sampling, cannabis plants had reached a
growth extending from the plug along the stem surface height of 1.2–1.6 m and were 1.8–2 m wide and in full
was rated on a scale of 0 to 4, where 0 = no growth flower (Fig. 1a) after 16 weeks of growth. Diseased
from plug, no browning; 1 = growth covering up to plants exhibited a general yellowing of the foliage
25% of the stem surface, mild browning; 2 = growth (Fig. 1b), or in some cases showed more pronounced
extending up to 50% of the stem surface, visible yellowing on one side of the plant (Fig. 1c). Some
browning; 3 = growth extending up to 75% of the plants showed a complete wilting that progressed
stem surface, extensive browning; and 4 = growth within 48–72 h (Fig. 1d) under extremely hot condi-
covering the entire stem segment, severe browning. tions (daytime temperatures exceeding 35°C). In many
Z. K. Punja et al. 536

cases, these plants died rapidly and became desiccated canker disease on almond seedlings in California
(Fig. 1e). Four of the six severely affected plants had (GenBank KX421379.1) (Stack et al., 2017). All isolates
dark sunken areas at the crown that extended upward of F. brachygibbosum from cannabis produced distinctly red
15 cm from the soil surface (Fig. 1f). A closer exam- pigmented colonies on PDA (Fig. 2f). Sequences of F.
ination of the crown region showed the darkening of oxysporum isolates CA-1 and CA-2 have been deposited in
the tissues extended into the roots below the soil sur- GenBank (accession nos. MH789985 and MH789986 for
face (Fig. 2a) and many of the roots were necrotic. ITS and MH844832 and MH844833 for EF-1α) and F.
Mycelial growth could be observed in the sunken areas brachygibbosum isolates F and G (accession nos.
at the crown (Fig. 2b). Removal of the bark revealed a MH789987 and MH789988 for ITS and MH844834 and
dark staining and rot of the underlying tissues that MH844836 for EF-1α).
progressed upwards from the crown (Fig. 2c,d).
When the stem was split, the reddish-brown internal
decay could be seen originating from the crown and Pathogenicity tests
root zone and extended upwards (Fig. 2e). The symp-
toms observed are characteristic of a crown rot disease For the inoculation experiments on rooted cannabis
as they were not limited to the vascular tissues. plants, two representative isolates each of F. oxy-
sporum, F. brachygibbosum, F. solani, P. aphaniderma-
tum and F. equiseti were included; the inoculum levels
Identification of cultures ranged from 1 × 102 to 1 × 103 CFU per mL for P.
aphanidermatum and 1 × 10 4 to 1 × 10 5 for the
From around 120 plated tissue segments originating from Fusarium species. Isolates of F. oxysporum, F. brachy-
six diseased plants, each one produced colonies that were gibbosum and P. aphanidermatum caused similar reduc-
identified as Fusarium or Pythium species based on mor- tions in root length compared with the non-inoculated
phological characteristics of these genera (Fig. 2f). The control plants (Fig. 5a). Only plants that were wounded
Pythium colonies were fast-growing (covering a 9 cm prior to inoculation showed a reduction in root growth;
diameter Petri dish in 2–3 days) and two isolates 2–6 non-wounded inoculated plants did not develop symp-
and 3–2 (GenBank accession nos. MH789989 and toms (data not shown). Inoculation with F. solani (iso-
MH789990) were identified as P. aphanidermatum lates Fs, F5) caused the greatest reduction in root
(100% identity with GenBank sequences KU211462.1 length, confirming the observations from a recent
from soybean (Rojas et al., 2017) and AY598622.2 from study on the pathogenicity of this species on cannabis
CBS118.80 (Levesque & de Cock, 2004)). The frequency plants (Punja & Rodriguez, 2018). While F. equiseti
of recovery was 22% and all isolates originated from the was not pathogenic on plants (data not shown), this
bark or cortical tissues taken from dark sunken regions at species has also been recovered from cannabis flower
the crown. The remaining 78% of isolates were identified buds and was shown to be weakly pathogenic on flow-
as Fusarium oxysporum (40% frequency), F. brachygib- ers compared with the highly aggressive F. solani
bosum (28% frequency), Fusarium solani and F. equiseti (Punja, 2018). Plants inoculated with F. oxysporum
(5% frequency each) (Fig. 2f). Isolates of these species and F. solani developed symptoms of stunting and
(except F. equiseti) originated from outer bark, cortical yellowing (Fig. 6a) while isolates of F. brachygibbo-
and vascular tissues; isolates of F. equiseti originated from sum and P. aphanidermatum caused stunting of plants
the bark only. within 5 weeks following inoculation (Fig. 6b). Total
Phylogenetic analysis of two isolates of F. oxysporum collapse and death of some plants was observed follow-
(CA-1, CA-2) using the ITS and EF-1α regions placed ing inoculation with P. aphanidermatum (Fig. 6c).
them within a clade that contained isolates of different for- Browning of the pith tissues was observed following
mae specialis from a range of hosts (Fig. 3a,b), including inoculation with F. oxysporum isolate CA-2 (Fig. 6d)
two isolates of F. oxysporum from British Columbia (BC-1, which developed within 2–3 weeks after inoculation
BC-2) that were recovered from the roots of hydroponically and progressed upwards from the crown region within
grown cannabis plants (Punja & Rodriguez, 2018). The two 5 weeks (Fig. 6e). A general discolouration of the bark
isolates of F. brachygibbosum (F, G) were grouped with a and inner cortical tissues was observed following
range of isolates of this species from other hosts and sources, inoculation with P. aphanidermatum (Fig. 6f).
and were distinct from isolates of F. oxysporum and F. solani The recovery of four pathogenic species from diseased
(Fig. 4a,b). There was 100% sequence identity in the EF-1α crown and vascular tissues of cannabis plants makes the
region with an isolate of F. brachygibbosum causing a establishment of the importance of each individual
Root and crown rot pathogens on field-grown marijuana 537

species difficult to discern. Species of Fusarium and

Pythium were reported to infect roots of hydroponically
grown cannabis plants (Punja & Rodriguez, 2018) but
this is the first report showing F. brachygibbosum as a
pathogen on cannabis. Wounding was required for infec-
tion by all isolates tested – such wounds can develop
during transplanting in the field or from rodent damage
to the root system that had occurred on many plants in
this particular field earlier in the growing season (A.
Abare, personal communication).
Inoculation of stem tissues showed that all pathogens
were capable of causing extensive browning (Fig. 7a),
accompanied by mycelial colonization (Figs 5b and 7b),
while profuse sporulation was observed on the stem
surface by the Fusarium species (Fig. 7c,d,e). Wounded
control stems had only mild browning. The aerial release
of spores from colonized stem tissues of diseased canna-
bis plants can result in spread of inoculum to adjacent
plants in the field, as well as onto flower buds (Punja,
2018). Spread of F. oxysporum from diseased plant tis-
sues has been reported for a number of hosts (Rowe
et al., 1977; Gamliel et al., 1996; Katan et al., 1997;
Rekah et al., 2000; Scarlett et al., 2015). Additional
inoculum sources may be from the planting medium or
from soil and diseased plants in adjacent fields. The
isolates of F. brachygibbosum (F, G) from cannabis
plants showed identical ITS sequences to those recov-
ered previously from propagated almond trees in north-
ern California (Stack et al., 2017). The symptoms on
almond included cankers on bare-root trees in cold sto-
rage or in the field soon after planting, which resulted in
death of numerous trees. The pathogen was also recov-
ered from asymptomatic tissues, soil, adjacent wheat
rotation crop and the surface of field equipment (Stack
et al., 2017) and is believed to be widespread in
California soils and is likely an opportunistic pathogen
(Chitambar, 2016). Fusarium brachygibbosum has also
been reported to cause a stalk rot of corn in China (Shan
et al., 2017), characterized by a dark brown disintegra-
tion of internal stalk tissues. Watermelon wilt and plant
death due to F. brachygibbosum was also reported from
Sonora, Mexico, which caused a cortical rot on the upper
portion of the taproot (Renteria-Martinez et al., 2015).
Fig. 5 Effect of inoculation of cannabis plants and stem tissues with Other plant species on which stem die-back and wilt
F. oxysporum, F. brachygibbosum, F. solani and P. aphanidermatum. were reported to be caused by F. brachygibbosum
(A) Reduction in root length compared with the non-inoculated include olive in Tunisia (Trabelsi et al., 2018) and
control. Data are from four replicate plants; (B) Stem colonization
by mycelium. Data are from 5 replicate stems. Both experiments
Euphorbia in Oman (Al-Mahmooli et al., 2013). The
were conducted twice. Data are the means ± standard error. symptoms observed on cannabis plants i.e. wilting, die-
Z. K. Punja et al. 538

Fig. 6 (Colour online) Pathogenicity studies conducted on rooted cannabis cuttings using isolates of Fusarium and Pythium species. (A) F.
oxysporum (middle plant) and F. solani (right plant) compared with control plant (far left). Photo was taken 5 weeks after inoculation and
shows yellowing and stunting symptoms; (B) Non-inoculated plant (far right) compared with F. brachygibbosum-inoculated (middle) and P.
aphanidermatum-inoculated plant (far left). Inoculated plants were stunted after 5 weeks; (C) Plant death following inoculation with P.
aphanidermatum; (D) Internal pith discolouration progressing upwards from the crown region in a F. oxysporum-inoculated (isolate CA-2)
plant; H) Advanced pith and xylem discolouration 5 weeks following F. oxysporum inoculation; (I) General discolouration of the bark and
inner cortical tissues following inoculation with P. aphanidermatum.

back, root and crown rot, are consistent with the reports Both F. oxysporum and F. solani have been reported to
of F. brachygibbosum symptom development on other cause root and crown rot on a number of different hosts
host plants. In addition, on young inoculated plants, worldwide (Nagao et al., 1994; Ozbay & Newman,
disease symptoms include stunting and yellowing of 2004; Golzar et al., 2007; Punja & Parker, 2009;
lower leaves. Moya et al., 2011; Elmer, 2015), while P. aphanider-
While F. oxysporum was the most frequently isolated matum causes root and crown rot on many species as
pathogen in this study (40%), the recovery of F. bra- well, especially at temperatures of 30–35°C (Kucharek
chygibbosum (28% frequency) and P. aphanidermatum & Mitchell, 2000; Sutton et al., 2006). On industrial
(22% frequency) and their pathogenicity on cannabis hemp plants, P. aphanidermatum was recently reported
plants suggest they likely have a role in the disease to cause stunting and wilting, with rotted roots and
complex. Simultaneous co-inoculations of multiple crown lesions (Beckerman et al., 2017; Schoener
pathogens were not performed in this study but may et al., 2017), and was previously reported to cause
have additive effects in promoting disease symptoms. seedling damping-off (McPartland, 1996). Collapse of
On olive and watermelon plants, other species of some plants following inoculation with P. aphanider-
Fusarium, including F. solani and F. oxysporum, were matum was observed in the present study, as reported
also associated with diseased tissues that contained F. by Beckerman et al. (2017). Collapse and death of
brachygibbosum, as part of a disease complex hydroponically grown cannabis plants under greenhouse
(Renteria-Martinez; Trabelsi et al., 2017). On almond, conditions due to P. aphanidermatum has also recently
both F. acuminatum and F. avenaceum were also found been reported from British Columbia (Punja &
to be present in diseased tissues (Marek et al., 2013). Rodriguez, 2018).
Root and crown rot pathogens on field-grown marijuana 539

Fig. 7 (Colour online) Inoculation of wounded cannabis stem tissues with Fusarium and Pythium species. (A) Internal browning
accompanied by mycelial colonization by Fusarium species after 7 days. Inoculations made were (left to right): control (wounded only),
F. oxysporum, F. solani, F. brachygibbosum; (B) Inoculation with P. aphanidermatum showing internal browning (left) and external mycelial
colonization (right); (C) Profuse sporulation on the surface of the bark of stems following inoculation with F. oxysporum (top), F. solani
(middle) and F. brachygibbosum (bottom). Photographs were taken 7 days after inoculation with mycelial plugs that were placed on the
surface of the wounded stems; plugs were removed prior to photographs being taken; (D, E) Scanning electron microscopy images of profuse
sporulation of F. oxysporum on cannabis stem surfaces.

The presence of multiple species of Fusarium, in addition decline and death of infected plants, especially under hot
to P. aphanidermatum, on cannabis plants, is likely to weather or water-stressed conditions. Predisposition of can-
exacerbate the disease symptoms and contribute to a rapid nabis plants during periods of excessive heat or drought is
Z. K. Punja et al. 540

possibly a contributing factor in promoting disease. On Gettman J 2006. Marijuana production in the United States (2006).
Bulletin of cannabis reform. Issue 2. Accessed 2018 Apr 9. https://
almond, cold-stored nursery stock with cryptic infection by
www.drugscience.org/Archive/bcr2/domstprod.html
F. brachygibbosum developed disease under conditions of Golzar H, Phillips D, Mack S. 2007. Occurrence of strawberry root and
predisposing physiological stress (Stack et al., 2017). Our crown rot in western Australia. Australas Plant Dis Notes. 2:145–147.
observations suggest that cannabis strains can differ in sus- Katan T, Shlevin E, Katan J. 1997. Sporulation of Fusarium oxysporum
f. sp. lycopersici on stem surfaces of tomato plants and aerial dissemi-
ceptibility to root and crown rot although there have been no
nation of inoculum. Phytopathology. 87:712–719.
previous efforts to screen different strains for potential tol- Kucharek T, Mitchell D. 2000. Diseases of agronomic and vegetable
erance to disease. Management of root and crown rot of crops caused by Pythium species. Plant Pathology Factsheet PP-53.
cannabis will necessitate an integrated approach that will Gainesville (FL): University of Florida. Accessed 2018 May 1.
http://plantpath.ifas.ufl.edu/media/plantpathifasufledu/factsheets/
require knowledge of the source(s) of inoculum, understand-
pp0053.
ing the role of predisposing stress factors, and the effects of Laate EA 2012. Industrial hemp production in Canada. Alberta agricul-
soil-associated factors such as moisture levels, microbial ture and rural development publication. Accessed 2017 Sep 16. http://
activity and nutrient levels, on disease development. www1.agric.gov.ab.ca/$department/deptdocs.nsf/all/econ9631.
Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. 1st
ed. Iowa (IA): Blackwell.
Levesque CA, de Cock AW. 2004. Molecular phylogeny and taxonomy
Acknowledgements of the genus Pythium. Mycol Res. 108:1363–1383.
Marek SM, Yaghmour MA, Bostock RM. 2013. Fusarium spp.,
We thank Alex Abere for making available diseased plant Cylindrocarpon spp., and environmental stress in the etiology of a
tissue samples and providing images of disease symptoms canker disease of cold-stored fruit and nut tree seedlings in California.
Plant Dis. 97:259–270.
and a commercial grower for providing access to the produc- McPartland JM. 1996. A review of Cannabis diseases. J Intern Hemp
tion site. Scanning electron microscopy was conducted by Assoc. 3:19–23.
Darren Sutton. McPartland JM, Hillig KW. 2004. Cannabis Clinic – fusarium wilt. J
Industr Hemp. 2:67–77.
Moya E, Rew LJ, Jacobsen BJ, Hogg AC, Dyer AT. 2011. Distribution
and prevalence of fusarium crown rot and common root rot pathogens of
Funding wheat in Montana. Plant Dis. 95:1099–1108.
Nagao H, Sato K, Ogiwara S. 1994. Susceptibility of Cucurbita spp. to
This research was funded by the Natural Sciences and the cucurbit root rot fungus, Fusarium solani f.sp. cucurbitae race 1.
Engineering Research Council of Canada (NSERC), Agronomie. 14:95–102.
Collaborative Research and Development Grant. O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple
evolutionary origins of the fungus causing Panama disease of banana:
concordant evidence from nuclear and mitochondrial gene genealogies.
Proc Natl Acad Sci USA. 95:2044–2049.
References Ozbay N, Newman SE. 2004. Fusarium crown and root rot of tomato and
control methods. Plant Pathol J. 3:9–18.
Al-Mahmooli IH, Al-Bahri YS, Al-Sadi AM, Deadman ML. 2013. Punja ZK. 2018. Flower and foliage-infecting pathogens of marijuana
First report of Euphorbia larica dieback caused by Fusarium brachy- (Cannabis sativa L.) plants. Can J Plant Pathol. 40:4, doi:10.1080/
gibbosum in Oman. Plant Dis. 97:687. 07060661.2018.1535467
Anonymous. 2017. Deep Dive: the US Cannabis Industry and the New Green Punja ZK, Parker M. 2009. Development of fusarium root and stem rot, a
Economy—a Fast-Growing industry facing regulatory concerns. Accessed new disease on greenhouse cucumber in British Columbia caused by
2018 Apr 3. https://www.fungglobalretailtech.com/research/deep-dive-us- Fusarium oxysporum f.sp. radicis-cucumerinum. Can J Plant Pathol.
cannabis-economy-fast-growing-industry-facing-regulatory-concerns/. 22:349–363.
Beckerman J, Nisonson H, Albright N, Creswell T. 2017. First report Punja ZK, Rodriguez G. 2018. Fusarium and Pythium species infecting
of Pythium aphanidermatum causing crown and root rot of industrial roots of hydroponically grown marijuana (Cannabis sativa L.) plants.
hemp in the United States. Plant Dis. 101:1038. Can J Plant Pathol. 40:4, doi:10.1080/07060661.2018.1535466
Chitambar J 2016. California Department of Food and Agriculture. Rekah Y, Shtienberg D, Katan J. 2000. Disease development following
California pest rating for Fusarium brachygibbosum Padwick 1945. infection of tomato and basil foliage by airborne conidia of the soilborne
Accessed 2018 Apr 3. cdfa.ca.gov/Section3162/?p=2586. pathogens Fusarium oxysporum f. sp. radicis- lycopersici and F. oxy-
Elmer WH. 2015. Management of fusarium crown and root of asparagus. sporum f. sp. basilici. Phytopathology. 90:1322–1329.
Crop Prot. 73:2–6. Renteria-Martinez ME, Meza-Moller A, Guerra-Camacho MA,
Felsenstein J. 1985. Phylogenies and the comparative method. Amer Romo-Tamayo F, Ochoa-Meza A, Moreno-Salazar SF. 2015. First
Naturalist. 125:1–15. report of watermelon wilting caused by Fusarium brachygibbosum in
Gamliel A, Katan T, Yunis H, Katan J. 1996. Fusarium wilt and crown Sonora, Mexico. Plant Dis. 99:729.
rot of sweet basil: involvement of soilborne and airborne inoculum. Rojas JA, Jacobs J, Napieralski S, Karaj B, Bradley CA, Chase T,
Phytopathology. 86:56–62. Esker P, Giesler L, Jardine D, Malvick D, et al. 2017. Oomycete
Root and crown rot pathogens on field-grown marijuana 541

species associated with soybean seedlings in North America. in hydroponic crops: current knowledge and perspectives. Summa
Identification and pathogenicity characterization. Phytopathology. Phytopathol. 32:307–321.
107:280–292. Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large
Rowe RC, Farley JD, Coplin DL. 1977. Airborne spore dispersal and phylogenies by using the neighbor-joining method. Proc Nat Acad Sci
recolonization of steamed soil by Fusarium oxysporum in tomato green- USA. 101:11030–11035.
houses. Phytopathology. 67:1513–1517. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for 2011. MEGA5: molecular evolutionary genetics using maximum
reconstructing phylogenetic trees. Mol Biol Evol. 4:406–425. likelihood, evolutionary distance, and maximum parsimony meth-
Scarlett K, Tesoriero L, Daniel R, Maffi D, Faora F, Guest DI. 2015. ods. Mol Biol Evol. 28:2731–2739.
Airborne inoculum of Fusarium oxysporum f. sp. cucumerinum. Eur J Trabelsi R, Gdoura R, Triki M. 2018. Fusarium brachygibbosum
Plant Pathol. 141:779–787. and Fusarium chlamydosporum causing wilt and die-back of olive
Schoener J, Wilhelm R, Wang S. 2017. Pythium aphanidermatum in Tunisia. In: Kallel A, Ksibi M, Ben Dhia H, Khélifi N, editors.
crown rot of industrial hemp. Western Plant Diagnostic Network First Proceedings of the Euro-Mediterranean Conference for
Detector News Vol. 12(9): 1–2. Accessed 2018 May 7. https://www. Environmental Integration EMCEI 2017. “Recent Advances in
npdn.org/system/files/NPDN_September-17. Environmental Science from the Euro-Mediterranean and
Shan LY, Cui WY, Zhang DD, Zhang J, Ma NN, Bao YM, Dai XF, Surrounding Regions”. Advances in Science, Technology &
Guo W. 2017. First report of Fusarium brachygibbosum causing maize Innovation (ASTI) book series. Springer Publishing; p. 581–582.
stalk rot in China. Plant Dis. 101:837. Trabelsi R, Sellami H, Gharbi Y, Krid S, Cheffi M, Kammoun S,
Stack AJ, Yaghmour MA, Kirkpatrick SC, Gordon TR, Bostock Dammak M, Mseddi A, Ddoura R, Ali Triki M. 2017.
RM. 2017. First report of Fusarium brachygibbosum causing cankers Morphological and molecular characterization of Fusarium spp. asso-
in cold-stored, bare-root propagated almond trees in California. Plant ciated with olive trees dieback in Tunisia. 3 Biotech. 7:28.
Dis. 101:290. Van der Plaats-Niterink AJ. 1981. Monograph of the genus Pythium.
Sutton JC, Sopher CR, Owen-Going TN, Liu W, Grodzinski B, Hall Stud Mycol. No. 21. Centraalbureau Voor Schimmelcultures. Baarn:
JC, Benchimol RA. 2006. Etiology and epidemiology of Pythium root rot The Netherlands; p. 242.