1.

Abstract
This experiment used Polymerase Chain Reaction (PCR) and gel electrophoresis to determine the sex
of a DNA sample based on the amplification of the amelogenin gene. The Amelogenin gene which is
located on both the X and Y chromosomes, produce bands that have very different molecular weights.
DNA was extracted and quantified using a Nanodrop spectrophotometer and amplified using PCR.
The sample was loaded into agarose gel stained with SYBR green and analysed under a UV
transilluminator. A single band corresponding to the AMELX gene was observed in all test samples
and the positive control which indicates female DNA. A faint band was seen in the negative control,
suggesting possible contamination.

2. Introduction
Polymerase Chain Reaction (PCR) also known as “molecular photocopying”, is a laboratory
technique which amplifies small segments of Deoxyribonucleic Acid (DNA) to produce millions of
copies of a particular section of DNA. It’s a fast and inexpensive process that involves denaturation,
annealing and extension, each with their own temperature and time. Even if the starting amount of
DNA is very small, PCR can multiply it so that it will be sufficient for analysis or testing.
Agarose gel electrophoresis is a technique that is used to separate DNA fragments by their molecular
weight into bands so they can be analysed. It makes use of an electric field to separate the protein
molecules. The samples are pipetted into wells found on the gel, DNA then moves towards the
positive end of the field but large molecules move slower than smaller molecules which produces
bands at different molecular weights to be interpreted at the end. (Khan academy, n.d.)
A commonly used technique for sex determination is using the amelogenin gene, which is present on
both the X and Y chromosomes. (The Amelogenin Gene, 1995) The variants of amelogenin, AMELX
and AMELY are almost the same and only differ by a small difference which allows for the design of
the primer to amplify both versions of the gene in a single PCR reaction. The amplification usually
results in 2 distinct bands for male DNA (AMELX and AMELY) and 1 distinct band for female DNA
(AMELX) due to the absence of Y chromosome in females. (Fontanesi Et Al., 2008)
In this experiment, PCR was used to amplify the DNA, specifically the amelogenin gene from the
DNA sample to determine the sex. The products were analysed using agarose gel electrophoresis to
visualise the presence or absence of AMELY specific bands. A positive control (known female DNA)
and a negative control (water) were used to ensure the reliability and specificity of the PCR, amd that
the reagents are functioning properly.
3. Objective
The objective is to use PCR and agarose gel electrophoresis to accurately determine the sex of the
sample based on the band patterns observed on the gel under UV light.
 Figure 1: Flow chart showing the flow of experiment
4. Methods and materials
2.1 Extracting DNA
Materials

• Sterile bucca swab

• BLS solution
• Protease K
• BP solution (precipitation buffer solution)
• TE solution
• DNA rehydration buffer
• Centrifuge tubes (2mL and 50mL)
• Microcentrifuge
• Vortex machine
Method
Saliva sample containing buccal cells was collected from a dog using a sterile buccal swab. After
collection, the swab was stirred in the tube containing 500 µL of BLS solution and removed, the tube
was sealed and inverted gently to mix. The tube was stored for a week at room temperature. To begin
the extraction process, 20 µL of protease K solution was added directly into the tube with the saliva
sample and BLS solution. The tube was briefly vortexed, incubated in a 60 °C water bath for one hour
and vortexed again. The solution was transferred into a 1.5mL centrifuge tube using a micropipette
with sterile pipette tip. 500 µL of BP solution was added to the tube and vortexed briefly, the solution
was slightly cloudy faster that. The tube was then centrifuged at maximum speed, 13,400rpm for 10
minutes, the solution contained DNA with impurities. After removing the supernatant with a sterile
pipette, the tube was briefly vortexed again to collect any remaining liquid which was also removed.
To resuspend the DNA, 100 µL of TE buffer was added, the tube was vortexed for 20 seconds to
dislodge and disperse the white pellet. After 5 minutes at room temperature, the sample was vortexed
again for 10 seconds. The tube was then centrifuged again for 15 minutes to remove insoluble
impurities, the clear supernatant containing the purified DNA was transferred into a new sterile 1.5mL
tube.The DNA concentration and purity were measured using a Nanodrop spectrophotometer. After
selecting the “Nucleic Acid” and “dsDNA” setting, 2µL of the DNA sample was loaded onto the
instrument pedestal. The readings for DNA concentration, A260, A280, and A260/A280 ratio were
recorded.
2.2 Polymerase Chain Reaction (PCR)
Materials

• Dog saliva sample

• Amelogenin primer
• PCR master mix
• Sterile water
• 0.5mL PCR tube
• Micropipette
• Microcentrifuge
• PCR thermocycler

Figure 2: Table of calculation of the amount of sample and reagent needed

To perform PCR amplification of the amelogenin from canine DNA, a reaction mixture was first
prepared in a separate tube to minimize pipetting errors. The target fragment size should be 182-
217bp and the amelogenin primer sequence used is GTGCCAGCTCAGCAGCCCGTGGT for
forward and TCGGAGGCAGAGGTGGCTGTGGC for reverse. The reaction mixture consisted of
forward and reverse amelogenin primers (1.2 µL each), PCR master mix (15 µL), and sterile Milli-Q
water (7.6 µL) per 30 µL reaction, calculated for five reactions in total. Four PCR tubes were then
prepared and labelled for two canine DNA duplicates, a positive control, and a negative control. From
the master tube, 25 µL of the PCR mix was added into each tube using a micropipette. Subsequently,
5 µL of template DNA (8.9 ng/µL) was added to each sample tube, while 5 µL of water was added to
the negative control. Each reaction contained a final DNA amount of 1.5 ng. The tubes were then
placed into a PCR thermocycler for amplification, following a thermal cycling protocol optimized for
the amelogenin primers and the target fragment size. It will then undergo thermocycling on these
settings: 9 5C for 5 min (initial denaturation), 95C for 30 s (denaturation), 65C for 60 s (annealing)
for 35 cycles, 72C for 60 s (extension) and 72C for 10 min (final extension). The sample was then
stored at -20oC for a week.
2.3 Gel Electrophoresis
Materials
For agar:

• Agarose powder
• TAE buffer
For electrophoresis:

• Electrophoresis tank
• Power pack unit
• 50 Bp ladder
• DNA 6x loading dye
• Gel documentation system and UV transilluminator
Method
Agarose gel electrophoresis is a technique used to separate DNA fragments by size. After the gel has
solidified, 10 µL of DNA samples mixed with 2 µL of loading dye are loaded into wells alongside a
DNA ladder, which serves as a size reference. The positive control and negative controld samples
were also loaded into the wells. When an electric current is applied, negatively charged DNA
fragments migrate toward the positive end of the gel, with smaller fragments moving faster through
the agarose matrix than larger ones. Once separation is completed, typically after 45 to 60 minutes,
the gel is placed in a UV transilluminator, where SYBR green-stained DNA fragments appear as
glowing bands. The sizes of these bands are then determined by comparing them to the known
fragment sizes in the DNA ladder.

5. Results
5.1 DNA concentration and purity

Figure 2: Results for DNA concentration and purity from Nanodrop spectrophotometer

The DNA concentration measured using a Nanodrop spectrophotometer was 8.9 ng/µL. The
A260/A280 ratio was 1.20, indicating potential protein contamination, as pure DNA usually has a
ratio of ~ 1.8. The A260/A230 ratio was 2.77, which is above the ideal range of 2.0–2.2 and suggests
the presence of other contaminants such as phenol or carbohydrates. The absorbance values at 260 nm
and 280 nm were 0.18 and 0.15, respectively. (Thermo Fisher Scientific, 2009)
5.2 Gel electrophoresis

Figure 3: Results of gel electrophoresis under UV transilluminator

The agarose gel electrophoresis image shows five lanes. Lane 1 contains a 50 bp DNA ladder with
multiple distinct bands of increasing size, which serves as a molecular size reference. Lanes 2, 3, and
4 each display one linear DNA band of digested PCR products. Lane 5 has a faint band

6. Discussion

The gel electrophoresis results in Figure 2 show successful amplification of DNA fragments
using PCR, with clear separation of bands based on fragment size. Lanes 2 to 4 each have one
distinct linear bands, which shows that only the X chromosome version of the gene
(AMELX) was amplified while the Y chromosome version (AMELY) was not. This shows
that the sample was from a female. These results are consistent with expected outcomes for
sex determination with PCR, demonstrating that the experimental design and primer selection
were effective.

However, the relatively faint band in lane 3 may point to suboptimal DNA quality or
concentration, as supported by the Nanodrop measurements in Figure 3. The DNA
concentration was low at 8.9 ng/µL, and the A260/A280 ratio of 1.20 suggests possible
protein contamination, which may have impacted the PCR efficiency. The A260/A230 ratio
was slightly high at 2.77, which could indicate the presence of residual contaminants like
phenol or salts. (Thermo Fisher scientific, 2009) The slightly low DNA concentration could
have been the result of removing the buccal swab instead of leaving it in the tube until the
experiment starts. These findings suggest that further purification of the DNA sample may
enhance downstream amplification consistency.
Lane 5 is the negative control and a faint band was observed. The expected results should be
an absence of a band as water should not be amplified. The faint band suggests that there
might have been contamination either from the pipetting tips, the water, aerosol
contamination during pipetting or splashing/leaking between wells when loading the gel.

This highlights the need for contamination control practice like ensuring that pipette tips are
changed between each test sample, positive control and negative control. A separate pipette
can also be used to handle template DNA and reaction mix, the tubes should also remain
closed until use.

7. Conclusion

This experiment has demonstrated the use of PCR and gel electrophoresis for determination
of sex using amelogenin gene amplification. Both the sample and control lanes show a single
band corresponding with the AMELX gene, indicating that the sample is from a female and
the positive control is a known female sample. The positive control produced the expected
result, confirming that the PCR and reagents are functioning properly. However, the faint
band found on lane 5 which is the negative control suggests potential contamination that
could have occurred during the preparation of the sample or during pipetting and this
highlights the need for stricter contamination control practices. Aside from this, this method
was effective overall in identifying the sex based on PCR band patterns.
8. References
Khan Academy. (n.d.). https://www.khanacademy.org/science/ap-biology/gene-expression-and-
regulation/biotechnology/a/gel-
electrophoresis#:~:text=Gel%20electrophoresis%20is%20a%20technique,move%20towards
%20the%20positive%20electrode.
Kroemer T. (n.d.) How to interpret DNA gel electrophoresis
resultshttps://goldbio.com/articles/article/Interpreting-Gel-Electrophoresis-
Results?srsltid=AfmBOoplliw_KFoYpxWYIpp923Ak0BYCOBNRkhIvjZQuChzf7KI-2aLo

Thermo Fisher Scientific - NanoDrop products. (2009). T042‐TECHNICAL BULLETIN NanoDrop

Spectrophotometers.https://dna.uga.edu/wp-content/uploads/sites/51/2019/02/Note-on-the-
260_280-and-260_230-Ratios.pdf
The amelogenin gene. (1995, February 1). PubMed. https://pubmed.ncbi.nlm.nih.gov/7626398/
Fontanesi, L. Et Al. (2008, April 2). Differences of the porcine amelogenin X and Y chromosome
genes (AMELX and AMELY) and their application for sex determination in pigs. Molecular
Reproduction and Development, 75(11), 1662–1668. https://doi.org/10.1002/mrd.20903