NCERT Solutions for Class 12 Biology Chapter 1 Sexual Reproduction in Flowering

Plants

Here are the NCERT Solutions for Class 12 Biology Chapter 1 titled Sexual
Reproduction in Flowering Plants:

1. Name the parts of an angiosperm flower in which the development of male

and female gametophytes take place.

Answer: In an angiosperm flower, the male gametophytes develop inside the

anthers, while the female gametophytes develop inside the ovules.

2. Differentiate between microsporogenesis and megasporogenesis. Which type

of cell division occurs during these events? Name the structures formed at the
end of these two events.

Answer:

• Microsporogenesis : This process occurs in the anthers, where a diploid

microspore mother cell undergoes meiosis to form haploid microspores.
This results in the formation of pollen grains.

• Megasporogenesis : This process occurs in the ovules, where a diploid

megaspore mother cell undergoes meiosis to produce haploid megaspores.
Only one of the four megaspores formed is functional, giving rise to the
embryo sac. Both processes involve meiosis, which is a type of cell division
that reduces the chromosome number by half.

Structures formed :

• Microsporogenesis: Pollen grain

• Megasporogenesis: Embryo sac

3. Arrange the following terms in the correct developmental sequence: Pollen

grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.
Answer: The correct developmental sequence is: Sporogenous tissue → Pollen
mother cell → Microspore tetrad → Pollen grain → Male gametes. The process
begins with the sporogenous tissue, which gives rise to pollen mother cells. These
cells divide and form microspore tetrads. The tetrads separate to form individual
pollen grains, which later mature to produce male gametes.

4. What is meant by monosporic development of female gametophyte?

Answer: Monosporic development refers to the formation of a female

gametophyte from a single functional megaspore. After meiosis, four megaspores
are produced, but only one of them remains functional and develops into the
female gametophyte, while the other three degenerate.

5. With a neat diagram, explain the 7-celled, 8-nucleate nature of the female
gametophyte.

Answer: The development of a 7-celled, 8-nucleate female

gametophyte occurs as follows:

• After the first mitotic division of the megaspore, two nuclei form and
migrate to opposite ends.

• These nuclei undergo further divisions to produce a total of eight nuclei,

four at each end.

• At the micropylar end, three of these nuclei differentiate into the egg cell
and two synergids.

• At the chalazal end, three nuclei differentiate into antipodal cells.

 • The remaining two nuclei from each end form the polar nuclei at the center.
Thus, the female gametophyte consists of seven cells and eight nuclei.

6. What are chasmogamous flowers? Can cross-pollination occur in

cleistogamous flowers? Give reasons for your answer.

Answer:

• Chasmogamous flowers are flowers that are open and expose their
reproductive organs, allowing cross-pollination.

• Cleistogamous flowers , on the other hand, are small and closed with
unexposed reproductive organs, preventing cross-pollination. These flowers
typically undergo self-pollination because the stigma and anther are in close
proximity to each other.

7. Mention two strategies evolved to prevent self-pollination in flowers.

Answer:

1. Dichogamy : This occurs when the male and female reproductive organs
mature at different times, preventing self-fertilization.

2. Self-incompatibility : A genetically controlled mechanism where the pollen

from the same flower is unable to fertilize its own ovule.

8. What is self-incompatibility? Why does self-pollination not lead to seed

formation in self-incompatible species?

Answer: Self-incompatibility is a genetic mechanism that prevents self-pollination,

ensuring cross-pollination. In self-incompatible species, the pollen from the same
flower cannot fertilize its own ovule, so no seed formation occurs.

9. What is the bagging technique? How is it helpful in a plant breeding

programme?

Answer: The bagging technique involves covering a flower with a protective bag to
prevent unwanted pollen from reaching the stigma. This ensures that only the
desired pollen fertilizes the flower. It is useful in plant breeding as it helps control
pollination and ensures that only specific traits are passed on to the next
generation.

10. What is triple fusion? Where and how does it take place? Name the nuclei
involved in triple fusion.

Answer: Triple fusion is the fusion of one male gamete with two polar nuclei in the
central cell of the embryo sac. This occurs after the pollen tube enters the ovule
and releases two male gametes. One male gamete fertilizes the egg cell, forming
the zygote, while the other fuses with the two polar nuclei to form the triploid
endosperm. The nuclei involved in triple fusion are:

• One male gamete nucleus

• Two polar nuclei

11. Why do you think a zygote is dormant for some time in a fertilized ovule?

Answer: The zygote remains dormant temporarily because the endosperm, which
provides nutrients to the developing embryo, must first form through triple
fusion. The endosperm nourishes the zygote until it is ready to develop into a
mature embryo.

12. Differentiate between the following pairs:

• Epicotyl and hypocotyl

• Coleoptile and coleorrhiza

• Integument and testa

• Perisperm and pericarp

Answer:

Epicotyl vs. Hypocotyl :

• Epicotyl is the part of the embryo above the cotyledons and becomes the
upper part of the stem.

• Hypocotyl is below the cotyledons and develops into the part of the stem
that forms the roots.

Coleoptile vs. Coleorrhiza :

• Coleoptile is a protective sheath that covers the plumule (young shoot) in

grasses.

• Coleorrhiza is a protective sheath that surrounds the radical (young root) in

grasses.

Integument vs. Testa :

• Integument is the outer covering of the ovule before fertilization.

• Testa is the seed coat formed after fertilization, providing protection to the
seed.

Perisperm vs. Pericarp :

• Perisperm is the part of the seed that provides nutrition, derived from the
nucellus.

• Pericarp is the part of the fruit that surrounds the seed and protects it.

13. Why is an apple called a false fruit? Which part of the flower forms the fruit?

Answer: An apple is called a false fruit because it is derived from the thalamus (a
part of the flower) rather than just the ovary. The fruit is formed from the
thalamus and the ovary.

14. What is meant by emasculation? When and why does a plant breeder
employ this technique?
Answer: Emasculation is the removal of stamens from bisexual flowers before the
anther matures. Plant breeders use this technique to prevent self-pollination and
ensure that only desired pollen fertilizes the flowers, thereby controlling the traits
of the offspring.

15. If one can induce parthenocarpy through the application of growth

substances, which fruits would you select to induce parthenocarpy and why?

Answer: Fruits like watermelon and muskmelon, which are usually seedless, would
be ideal candidates for inducing parthenocarpy. This is because seedless fruits are
in high demand, and parthenocarpy would allow for the production of such fruits
without fertilization.

16. Explain the role of tapetum in the formation of pollen grain walls.

Answer: The tapetum is the inner layer of the microsporangium that provides
nutrition to developing pollen grains. It helps in the formation of the exine layer of
the pollen grain, which is important for its protection and structural integrity. The
tapetum also produces essential proteins, enzymes, and hormones needed for
pollen maturation.

17. What is apomixis and what is its importance?

Answer: Apomixis is the process where seeds form without fertilization. This
process is useful in plant breeding because it allows for the production of hybrid
seeds without the need for sexual reproduction. Apomixis ensures that hybrid
characteristics are retained, making seed production more cost-effective.
NCERT Solutions for Class 12 Biology Chapter 2 Human Reproduction

Exercise: Reproductive System

1. Fill in the blanks:

(a) Humans reproduce sexually . (b) Humans are viviparous . (c) Fertilisation
is internal in humans. (d) Male and female gametes are haploid . (e) Zygote
is diploid . (f) The process of release of ovum from a mature follicle is
called ovulation . (g) Ovulation is induced by a hormone called luteinising
hormone (LH) . (h) The fusion of male and female gametes is called fertilisation .
(i) Fertilisation takes place in the ampulla of the oviduct . (j) Zygote divides to
form a blastocyst , which is implanted in the uterus. (k) The structure which
provides a vascular connection between the foetus and uterus is called
the placenta .

2. Draw a labelled diagram of the male reproductive system.

Ans-

3. Draw a labelled diagram of the female reproductive system.

Ans-
4. Write two major functions, each of the testis and ovary.

Ans-

Testis:

• Produces sperms through the process of spermatogenesis in the

seminiferous tubules.

• Secretes testosterone, the male sex hormone.

Ovary:

• Produces ova through the process of oogenesis.

• Secretes female sex hormones, estrogen and progesterone.

5. Describe the structure of a seminiferous tubule.

Ans-

Seminiferous tubules are highly coiled structures located inside the testicular
lobules. They are lined with germinal epithelium and consist of:

• Sertoli cells: Support and nourish the developing sperm.

• Spermatogonia: Male germ cells that undergo meiotic divisions to form

spermatids and eventually mature spermatozoa.

• Leydig cells: Located outside the tubules, they produce testosterone.

6. What is spermatogenesis?

Ans-

Spermatogenesis is the process of sperm production from spermatogonia in the

seminiferous tubules. It involves:

1. Transformation of diploid spermatogonia into primary spermatocytes.

2. Meiotic divisions resulting in haploid spermatids.

3. Maturation of spermatids into motile spermatozoa.

7. Name the hormones involved in the regulation of spermatogenesis.

Ans-

• Luteinising hormone (LH): Stimulates Leydig cells to produce androgens.

• Follicle-stimulating hormone (FSH): Stimulates Sertoli cells for

spermiogenesis.

• Gonadotropin-releasing hormone (GnRH): Stimulates the release of LH and

FSH.

• Androgens: Regulate spermatogenesis.

8. Define spermiogenesis and spermiation.

Ans-

• Spermiogenesis: The transformation of spermatids into mature, motile

spermatozoa.

• Spermiation: The release of mature spermatozoa from Sertoli cells into the
lumen of seminiferous tubules.

9. Draw a labelled diagram of sperm.

Ans-
10. What are the major components of seminal plasma?

Ans-

• Secretions from accessory glands (prostate gland, seminal vesicles,

bulbourethral glands).

• Contains calcium, fructose, and enzymes essential for sperm mobility and
survival.

11. What are the major functions of male accessory ducts and glands?

Ans-

• Ducts:

• Vasa efferentia: Transports sperms to the epididymis.

• Epididymis: Stores and matures sperms.

• Vas deferens: Conducts sperms to the urethra.

• Glands:

• Seminal vesicles: Secrete fructose-rich fluid for sperm energy.

• Prostate gland: Produces alkaline fluid to enhance sperm motility.

 • Bulbourethral glands: Neutralize acidity and lubricate the urethra.

12. What is oogenesis?

Ans-

Oogenesis is the process of ova formation in the ovary. It includes:

1. Multiplication of oogonia.

2. Growth of a primary oocyte surrounded by follicular cells.

3. Maturation leading to the formation of one ovum and polar bodies through
meiotic divisions.

13. Draw a labelled diagram of an ovary section.

Ans-

14. Mention the functions of the following:

(a) Corpus luteum – Progesterone (b) Endometrium – Implantation (c) Acrosome

– Fertilization (d) Sperm tail – Movement (e) Fimbriae – Ovulation

Ans-

(a) Corpus luteum – Secretes progesterone to prepare and maintain the uterine
lining for implantation.

(b) Endometrium – Innermost uterine lining that undergoes cyclic changes to

support embryo implantation .

(c) Acrosome – Contains enzymes that help the sperm penetrate the egg
membrane during fertilization.
(d) Sperm tail – Facilitates movement of the sperm within the female
reproductive tract.

(e) Fimbriae – Finger-like projections near the ovary that help collect the
ovum after ovulation.

15. Identify True/False statements.

(a) Androgens are produced by Sertoli cells. – False (b) Spermatozoa get nutrition
from Sertoli cells. – True (c) Leydig cells are found in the ovary. – False (d) Leydig
cells synthesise androgens. – True (e) Oogenesis takes place in the corpus luteum.
– False (f) Menstrual cycle ceases during pregnancy. – True (g) Presence or
absence of a hymen is not a reliable indicator of virginity or sexual experience. –
True

16. What is the menstrual cycle? Which hormones regulate the menstrual cycle?

Ans-

The menstrual cycle is a series of cyclic physiological changes in the female

reproductive system, lasting about 28 days . It prepares the uterus
for implantation and, in the absence of fertilization, results in menses —the
shedding of the uterine lining.

Hormones Regulating the Menstrual Cycle:

1. Follicle-Stimulating Hormone (FSH): Stimulates the development of ovarian

follicles.

2. Luteinizing Hormone (LH): Triggers ovulation and formation of the corpus

luteum.

3. Estrogen: Promotes follicle growth and thickening of the uterine lining.

4. Progesterone: Prepares and maintains the endometrium for implantation

and suppresses further ovulation.
NCERT Solutions for Class 12 Biology Chapter 3
Reproductive Health

1. What is the significance of reproductive health in society?

Ans-

Reproductive health means the complete well-being of a person in all aspects of

reproduction, including physical, emotional, and social health. It helps prevent the
spread of sexually transmitted diseases (like AIDS and gonorrhea) and avoids
complications from unwanted pregnancies. Educating young people about
reproductive health, safe practices, and equality ensures a healthier and more
aware society. It also helps control population growth and reduces social problems
like gender inequality.

2. What aspects of reproductive health need special attention today?

Ans-

Key areas needing focus are:

• Educating people on reproductive and child health.

• Promoting safe practices and hygiene during adolescence.

• Teaching about sexually transmitted diseases and their prevention.

• Introducing sex education in schools to clear myths and misconceptions.

• Supporting family planning, maternal care, and gender equality.

3. Is sex education necessary in schools? Why?

Ans-

Yes, sex education is very important in schools because:

• It clears doubts and myths about reproductive topics.

• Teaches adolescents about reproductive organs and safe practices.

 • Helps prevent sexually transmitted diseases and promotes healthier lives.

4. Has reproductive health improved in the last 50 years in India?

Ans-

Yes, reproductive health has improved significantly. For example:

• Infant and maternal mortality rates have decreased due to better

healthcare.

• More people are aware of family planning and use contraceptives.

• Immunization programs have improved child health.

5. What causes population explosion?

Ans-

Population explosion is caused by:

• Increased birth rates and life expectancy.

• Decreased death rates due to better healthcare and disease control.

6. Is the use of contraceptives justified?

Ans-

Yes, contraceptives are justified because they help control population growth and
prevent unwanted pregnancies. They also reduce the spread of sexually
transmitted diseases, promoting better health and well-being.

7. Why can’t removing gonads be a contraceptive method?

Ans-Removing gonads leads to infertility and stops the production of important

hormones needed for normal reproductive functions. Contraceptives are meant to
prevent pregnancy temporarily, not permanently affect a person's reproductive
ability.

8. Why is amniocentesis for sex determination banned in India?

Ans-Amniocentesis, meant for detecting genetic disorders, was misused for
determining a child’s gender, leading to female foeticide. To stop this harmful
practice, the government banned its use for sex determination.

9. What methods can help infertile couples have children?

Ans-Assisted Reproductive Technologies (ART) can help, such as:

• IVF (In Vitro Fertilization): Fertilizing an egg in a lab and transferring the
embryo to the mother.

• GIFT (Gamete Intrafallopian Transfer): Transferring eggs and sperm to the

fallopian tube for natural fertilization.

• Artificial Insemination (AI): Injecting healthy sperm into the uterus or

vagina.

• Surrogacy: Transferring an embryo to another woman who carries the baby.

10. How can sexually transmitted diseases (STDs) be prevented?

Ans-To avoid STDs:

• Avoid sharing needles or surgical equipment.

• Use condoms during sexual intercourse.

• Avoid unprotected sex with unknown or multiple partners.

• Seek medical help early if symptoms appear.

11. True/False with explanations:

Ans-

(a) Abortions can happen naturally. (True)

(b) Infertility is always due to female issues. (False) - It can be caused by problems
in males or females.
(c) Breastfeeding can act as contraception. (True) - But only for about six months
after childbirth.

(d) Awareness of sex-related issues improves reproductive health. (True)

12. Correct the following statements.

(a) Surgical methods of contraception prevent gamete formation.

(b) All sexually transmitted diseases are completely curable.

(c) Oral pills are very popular contraceptives among rural women.

(d) In E. T. techniques, embryos are always transferred into the uterus.

Ans-

1. Surgical methods of contraception prevent gamete flow during the act of

intercourse.

2. Some STDs can be cured if detected early and treated appropriately. But
AIDS still remains to be incurable.

3. Oral pills are very popular contraceptives among urban women.

4. In embryo transfer (E.T.) techniques, the 8-celled embryos are transferred

into the fallopian tube. Whereas more than 8-celled embryos are directly
transferred to the uterus.
NCERT Solutions for Class 12 Biology Chapter 4 Principles
of Inheritance and Variation

1. Mention the advantages of selecting a pea plant for the experiment by

Mendel.

Solution:

Mendel chose pea plants for his experiments because:

• Pea plants show clear, contrasting traits (e.g., tall vs. short, round vs.
wrinkled seeds, yellow vs. green pods), making it easier to study inheritance
patterns.

• Pea plants have bisexual flowers, allowing for self-pollination, which helps
in controlling the genetic cross.

• Cross-pollination can be easily controlled through emasculation.

• They have a short life cycle, producing many seeds quickly, which facilitates
the study of multiple generations.

2. Differentiate between the following.

(a) Dominance and Recessive

(b) Homozygous and Heterozygous

(c) Monohybrid and Dihybrid

Solution:

(a) Dominance and Recessive:

• Dominance: A dominant allele expresses itself in the presence of a

recessive allele.

• Recessive: A recessive allele only expresses itself in the absence of a

dominant allele.

(b) Homozygous and Heterozygous:

 • Homozygous: An individual has two identical alleles for a trait (e.g., TT or
tt).

• Heterozygous: An individual has two different alleles for a trait (e.g., Tt).

(c) Monohybrid and Dihybrid:

• Monohybrid: A cross between two organisms differing in a single trait (e.g.,

seed color).

• Dihybrid: A cross between two organisms differing in two traits (e.g., seed
color and seed shape).

3. A diploid organism is heterozygous for 4 loci; how many types of gametes can
be produced?

Solution:

A diploid organism heterozygous at four loci (e.g., Mm, Nn, Oo, Pp) can produce
16 different types of gametes, as each pair of alleles can produce two types of
gametes (e.g., M or m for the first locus, N or n for the second, etc.).

4. Explain the Law of Dominance using a monohybrid cross.

Solution:

The Law of Dominance, proposed by Mendel, states that when two different
alleles for a trait are present, the dominant allele will express itself while the
recessive allele will be suppressed. The recessive trait may reappear in the next
generation.
Example:

In a cross between a tall plant (RR) and a short plant (rr), all offspring in the F1
generation will be tall (Rr), as the tall allele (R) is dominant.

5. Define and design a test cross.

Solution:

A test cross is used to determine the genotype of an individual displaying a

dominant phenotype. This is done by crossing the individual with a homozygous
recessive individual.

Example:

Cross a tall (Tt) plant with a dwarf (tt) plant. If the offspring include both tall and
dwarf plants, the tall parent is heterozygous (Tt). If all offspring are tall, the tall
parent is homozygous (TT).

6. Using a Punnett Square, work out the distribution of phenotypic features in

the first filial generation after a cross between a homozygous female and a
heterozygous male for a single locus.

Solution:

In a cross between a homozygous female (bb) and a heterozygous male (Bb), using
a Punnett square would show the following possible genotypes for the offspring:
50% Bb (black coat color) and 50% bb (white coat color). The phenotypic ratio will

be 1:1.
7. When a cross is made between a tall plant with yellow seeds (TtYy) and a tall
plant with green seeds (Ttyy), what proportions of phenotype in the offspring
could be expected to be

(a) tall and green.

(b) dwarf and green.

Solution:

The phenotypic proportions for the offspring will be:

• 3 tall and green plants

• 1 dwarf and green plant

This results from the combination of different alleles for height and seed color.

Ty ty

TT Yy Tt Yy
TY
Tall yellow Tall yellow

TT yy Tt yy
Ty
Tall green Tall green

Tt yy tt yy
ty
Tall green Dwarf green

Tt Yy tt Yy
tY
Tall yellow Dwarf yellow
8. Two heterozygous parents are crossed. If the two loci are linked, what would
be the distribution of phenotypic features in the F 1 generation for a dihybrid
cross?

Solution:

If the genes are linked, the phenotypic distribution in the offspring will primarily
reflect the parental traits. There may be fewer recombinant phenotypes
compared to the expected 16 combinations due to incomplete linkage.

9. Briefly mention the contribution of T.H. Morgan to genetics.

Solution:

T.H. Morgan made several important contributions, including:

• Proving that genes are located on chromosomes.

• Discovering sex-linked inheritance.

• Studying gene linkage and recombination.

• Developing the concept of chromosome mapping.

10. What is pedigree analysis? Suggest how such an analysis can be useful.

Solution:

Pedigree analysis is the study of family history over generations to trace the
inheritance of specific traits. It is useful in:

• Identifying genetic disorders and understanding inheritance patterns.

• Helping genetic counselors assess the risk of genetic diseases.

• Understanding how certain traits are passed through families.

11. How is sex determined in human beings?

Solution:
Humans have an XX/XY sex determination pattern. Female sex chromosomes are
XX, while male sex chromosomes are XY. Females can only generate gametes with
X chromosomes, but males can produce gametes with both X and Y
chromosomes. When a male Y chromosome-containing gamete fertilizes with a
female X chromosome-containing gamete, the result is a male fetus. When a male
X chromosome-containing gamete fertilizes with a female X chromosome-
containing gamete, the fetus is female.

12. A child has blood group O. If the father has blood group A and the mother’s
blood group is B, work out the genotypes of the parents and the possible
genotypes of the other offspring.

Solution:

A set of three alleles – IA, IB and i – control the blood group characteristics in
humans. Where alleles IA and IB are equally dominant, and allele i is recessive to
the other alleles. The table below depicts the genotypes and blood groups.

Individuals with Genotype Blood Group They Would Possess

IA, IA, IA, i A

IB, IB, IB, i B

IA, IB AB

ii O

Thus, if the father has blood group A and the mother has blood group B, then the
possible genotype of the parents will be as follows:

A cross between
heterozygous parents will produce progenies with AB blood group (I A I B ) and O

group (ii).

13. Explain the following terms with an example.

(a) Co-dominance

(b) Incomplete dominance

Solution:

Co-dominance

Co-dominance refers to the situation where both alleles in a heterozygote are fully
expressed, neither being dominant over the other. Both alleles contribute equally
to the phenotype.

Example: In human blood groups, the A and B alleles are co-dominant. If a person
inherits the A allele from one parent and the B allele from the other, the result
is AB blood type, where both A and B antigens are expressed on the surface of red
blood cells.

Incomplete dominance

Incomplete dominance is the phenomenon where neither allele is completely

dominant over the other, leading to a blending of traits in the heterozygote. In the
F1 generation, the resulting phenotype is an intermediate expression of the two
parental traits.
Example: In Mirabilis jalapa (four o'clock plant), when a red-flowered plant is
crossed with a white-flowered plant, the F1 hybrid produces pink flowers, which is
a blend of the red and white traits, demonstrating incomplete dominance.

14. What is point mutation? Give one example.

Solution:

Point mutation refers to a genetic mutation where there is a change in a single

nucleotide base pair in the DNA sequence. This can occur due to a substitution,
insertion, or deletion of a single base pair, leading to a change in the codon, which
may result in a change in the protein produced. Point mutations can sometimes
cause significant effects, especially if they occur in crucial regions of the gene.

Example: Sickle Cell Anaemia

Sickle cell anaemia is caused by a point mutation where a single nitrogen base,
guanine, is replaced by adenine at the sixth codon of the β-globin gene. This
substitution causes the amino acid glutamic acid to be replaced by valine in the
hemoglobin protein. This slight change leads to the formation of sickle-shaped red
blood cells instead of the normal biconcave discs. The sickle-shaped cells are less
flexible and can obstruct blood flow, causing the symptoms of sickle cell anaemia,
such as pain and organ damage.

15. Who proposed the chromosomal theory of inheritance?

Solution:

The chromosome theory of inheritance was proposed by Walter Sutton and

Theodor Boveri in the early 20th century. They suggested that chromosomes,
which carry genes, are the vehicles of inheritance and that the segregation and
independent assortment of chromosomes during meiosis explain the inheritance
patterns observed by Gregor Mendel.

16. Mention any two autosomal genetic disorders with their symptoms.

Solution:
Autosomal Genetic Disorders and Their Symptoms

Down's Syndrome Symptoms :

• Flat hands and short neck

• Broad forehead

• Partially open mouth with a furrowed tongue

• Mongolian-type eyelid fold and stubby fingers

• Stunted psychomotor, physical, and mental development

• Heart deformities and deformities in other organs

• Underdeveloped genitalia and gonads

Sickle Cell Anaemia Symptoms :

• The shape of red blood cells (RBCs) changes from round, biconcave discs to
sickle-shaped (curved) under low oxygen tension.

• Sickle-shaped RBCs are rigid and less flexible, causing them to get stuck in
small blood vessels, which can lead to pain episodes, anemia, and organ
damage.

• Individuals may experience episodes of severe pain, known as "sickle cell

crises."

• Increased risk of infections, fatigue, and delayed growth.

NCERT Solutions for Class 12 Biology Chapter 5 Molecular
Basis of Inheritance

1. Group the following as nitrogenous bases and nucleosides:

• Adenine, Cytidine, Thymine, Guanosine, Uracil, and Cytosine.

Solution:

Nitrogenous Base Nucleosides

Adenine Cytidine

Thymine Guanosine

Uracil

Cytosine

2. If a double-stranded DNA has 20 percent of cytosine, calculate the percent of

adenine in the DNA.

Solution:As per Chargaff’s rule, DNA molecules must have an equal ratio of
purines (adenine and guanine) and pyrimidines (cytosine and thymine). This
means that the number of adenine molecules is equivalent to the number of
thymine molecules. Also, the percentage of guanine equals the percentage of
cytosine.

• If the double-stranded DNA has 20% cytosine, it also has 20% guanine.

• Therefore, the combined percentage of guanine and cytosine is 40%.

• The remaining 60% consists of adenine and thymine, which are equal.

• Hence, the percentage of adenine = 30%.

3. If the sequence of one strand of DNA is written as follows:

• 5′ -ATGCATGCATGCATGCATGCATGCATGC-3′

Write down the sequence of the complementary strand in a 5’→3′ direction.

Solution:The complementary sequence of the strand is obtained by replacing each
base with its pair:

• A pairs with T, T pairs with A, G pairs with C, and C pairs with G.

Thus, the complementary strand in the 3′→5′ direction is:

• 3′ – TACGTACGTACGTACGTACGTACGTACG – 5′

Reversing this to 5′→3′ direction:

• 5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

4. If the sequence of the coding strand in a transcription unit is written as

follows:

• 5′ -ATGCATGCATGCATGCATGCATGCATGC-3′

Write down the sequence of mRNA.

Solution:In transcription, thymine (T) is replaced with uracil (U) in RNA. Therefore,
the mRNA sequence corresponding to the coding strand is:

• 5′ -AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

5. Which property of the DNA double helix led Watson and Crick to hypothesize
a semi-conservative mode of DNA replication? Explain.

Solution:Watson and Crick proposed the semi-conservative model of DNA

replication based on the observation that the two strands of DNA are
complementary and anti-parallel. This means that each strand can serve as a
template for the synthesis of a new complementary strand. Thus, during
replication, each of the two strands would separate, and each would form a new
complementary strand, resulting in two DNA molecules, each consisting of one old
strand and one newly synthesized strand.

6. Depending upon the chemical nature of the template (DNA or RNA) and the
nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic
acid polymerases.
Solution:The types of nucleic acid polymerases are:

• DNA-dependent DNA polymerases

• DNA-dependent RNA polymerases

• RNA-dependent DNA polymerases

• RNA-dependent RNA polymerases

7. How did Hershey and Chase differentiate between DNA and protein in their
experiment while proving that DNA is the genetic material?

Solution:Hershey and Chase used radioactive isotopes to label DNA and protein
separately. They used phosphorus-32 (32P) to label DNA and sulfur-35 (35S) to
label proteins. After the bacteriophages infected E. coli bacteria, they found that
the radioactive phosphorus entered the bacteria, indicating that DNA, not protein,
was transferred and thus carried the genetic material.

8. Differentiate between the following:

(a) Repetitive DNA and Satellite DNA

• Repetitive DNA : Sequences that are repeated several times in the genome.
These sequences can vary in length from several base pairs to thousands.

• Satellite DNA : A subset of repetitive DNA, which consists of highly

repetitive sequences and can be separated from bulk DNA by density
gradient centrifugation.

(b) mRNA and tRNA

• mRNA : Serves as the template for protein synthesis, carrying the genetic
information from DNA to the ribosome.

• tRNA : Carries amino acids to the ribosome during translation, matching the
mRNA codon to the appropriate amino acid.

(c) Template Strand and Coding Strand

 • Template Strand : The DNA strand that serves as the template for mRNA
synthesis.

• Coding Strand : The DNA strand with the same sequence as the mRNA
(except thymine is replaced with uracil in RNA).

9. List two essential roles of the ribosome during translation.

Solution:

• Ribosomes are the sites for protein synthesis, where amino acids are linked
to form polypeptide chains.

• Ribosomes facilitate the attachment of tRNA, allowing the amino acids to

align properly for peptide bond formation.

10. In the medium where E. coli was growing, lactose was added, which induced
the lac operon. Why does the lac operon shut down sometime after the addition
of lactose in the medium?

Solution:The lac operon is activated when lactose binds to the repressor,

inactivating it, allowing RNA polymerase to transcribe the operon. However, once
lactose is metabolized and its concentration decreases, the repressor is
synthesized again, binds to the operator region, and prevents RNA polymerase
from transcribing the operon, thereby shutting it down.

11. Explain (in one or two lines) the function of the following:

• (a) Promoter : A region of DNA where RNA polymerase binds to initiate

transcription.

• (b) tRNA : An adaptor molecule that transfers specific amino acids to the
ribosome during protein synthesis.

• (c) Exons : Coding sequences in DNA that are transcribed into mRNA and
translated into proteins.

12. Why is the Human Genome Project called a mega project?

Solution:The Human Genome Project is called a mega project because it aimed to
map and sequence all the genes in the human genome, which took over 13 years
to complete. The project had a massive scale and scope, contributing to
advancements in genetics, biotechnology, and medicine.

13. What is DNA fingerprinting? Mention its application.

Solution:DNA fingerprinting is a technique used to identify and analyze variations

in DNA sequences. Applications include:

• Forensic identification (crime scene investigation).

• Establishing paternity or family relationships.

• Identifying genetic diversity in species.

• Preserving commercial strains of plants and animals.

14. Briefly describe the following:

• (a) Transcription : The process of synthesizing RNA from a DNA template,

resulting in mRNA formation.

• (b) Polymorphism : Genetic variation in a population due to differences in

DNA sequences.

• (c) Translation : The process where mRNA is decoded by ribosomes to

synthesize a polypeptide chain.

• (d) Bioinformatics : The application of computational tools to analyze and

interpret biological data, such as DNA sequences.
NCERT Solutions For Class 12 Biology Chapter 6 Evolution

1. Explain antibiotic resistance observed in bacteria in light of Darwinian

selection theory.

Answer:According to Darwin’s theory, organisms with beneficial traits survive

better in their environment. In the case of bacteria, when antibiotics are used,
most bacteria die, but a few with mutations that make them resistant survive.
These resistant bacteria multiply quickly because there’s less competition after the
sensitive bacteria die. Over time, this leads to a population of antibiotic-resistant
bacteria. These bacteria can also share their resistance genes with others, making
the problem worse.

2. Find out from newspapers and popular science articles any new fossil
discoveries or controversies about evolution.

Answer:A fascinating fossil discovery related to dinosaurs reveals their evolution

during the Jurassic era. This finding helped scientists understand how reptiles
evolved and how mammals and birds emerged. Recently, fossils
like Confuciusornis , an ancient bird from China, sparked debates about how birds
evolved from dinosaurs.

3. Attempt giving a clear definition of the term species.

Answer:A species is a group of organisms that can interbreed and produce

healthy, fertile offspring.

4. Trace the various components of human evolution.

Answer:

Human evolution involved changes in brain size, body posture, diet, and physical
features over time. The stages are as follows:

Human Stage Brain Size Posture Diet f

- Ape-like, Leaves, fruits

Dryopithecus Equal arms and legs,
knuckle-
Human Stage Brain Size Posture Diet f

africans walking large canines

Large molars, small

Ramapithecus - Semi-erect Nuts, seeds
canines

Australopithecus Used tools, lived on

450 cm³ Fully erect Herbivorous
africanus trees

Homo habilis 735 cm³ Fully erect Carnivorous First to make tools

800– Used advanced tools

Homo erectus Fully erect Omnivorous
1100 cm³ for hunting

Homo sapiens Developed culture,

1650 cm³ Fully erect Omnivorous
fossils made art

Homo sapiens 1200– Highly intelligent,

Fully erect Omnivorous
sapiens 1600 cm³ modern humans

5. Do animals other than humans have self-consciousness?

Answer:

Yes, some animals, like dolphins, show self-consciousness. They recognize

themselves in mirrors and communicate using unique whistles and movements.
Other self-aware animals include chimpanzees, parrots, crows, and orangutans.
6. List 10 modern-day animals and their corresponding ancient fossils.

Answer:

Modern Animal Fossil Name

Horse Eohippus

Man Ramapithecus

Elephant Moeritherium
Modern Animal Fossil Name

Whale Protocetus

Fish Arandaspis

Giraffe Palaeotragus

Dog Leptocyon

Camel Protylopus

Tetrapod Ichthyostega

Bat Archaeonycteris

7. Practice drawing various animals and plants.

Answer:Start by tracing outlines of animals and plants from books or magazines.

Use encyclopedias and the internet for more examples. Begin with simple
drawings, gradually adding details like leaves, flowers, or feathers.

8. Describe one example of adaptive radiation.

Answer:Adaptive radiation occurs when one species evolves into several different
species to adapt to various environments or food sources. A good example is
Darwin’s finches on the Galapagos Islands. From a common ancestor, finches
developed different beak shapes based on their diets, such as seed-eating, insect-
eating, and even blood-sucking.

9. Can we call human evolution adaptive radiation?

Answer:

No, human evolution isn’t considered adaptive radiation. Although humans

evolved from a common ancestor, this evolution didn’t lead to the formation of
multiple new species. Adaptive radiation refers to the diversification of one
species into many, which isn’t the case for humans.
10. Using various resources such as your school library or the internet and
discussions with your teacher, trace the evolutionary stages of any one animal,
say horse.

Answer:

The evolution of the horse began during the Eocene era with Eohippus and
progressed as follows:

Eohippus → Mesohippus → Merychippus → Pliohippus → Equus

Key evolutionary traits:

• Body size increased over time.

• Neck lengthened for better feeding.

• Third digit expanded, while other digits disappeared.

• Teeth became stronger for eating grass.

• Limbs became broader and more robust.