Fish & Shellfish Immunology 35 (2013) 1663e1669

Contents lists available at ScienceDirect

Fish & Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Short sequence report

Characterization of two negative regulators of the Toll-like receptor

pathway in Apostichopus japonicus: Inhibitor of NF-kB and
Toll-interacting protein
Yali Lu a, Chenghua Li a, *, Dongqun Wang b, Xiurong Su a, Chunhua Jin a, Ye Li a, Taiwu Li c
a
School of Marine Sciences, Ningbo University, Ningbo, Zhejiang Province 315211, PR China
b
Center of Cixi Agricultural Supervising and Testing, Ningbo, Zhejiang Province 315300, PR China
c
Ningbo City College of Vocational Technology, Ningbo, Zhejiang Province 315100, PR China

a r t i c l e i n f o a b s t r a c t

Article history: The Toll-like receptor (TLR) signaling cascade plays a central role in host cell recognition and responses to
Received 2 June 2013 microbial pathogens via the specific recognition of distinct pathogen-associated molecular patterns
Received in revised form (PAMPs). However, no negative regulators of the TLR-signaling cascade have been described in sea cu-
8 August 2013
cumber (Apostichopus japonicus). In the present study, two negative regulators known as the inhibitor of
Accepted 14 August 2013
Available online 24 August 2013
NF-kB (IkB) and Toll-interacting protein (Tollip) have been identified in coelomocytes of this species
using transcriptome sequencing and RACE (denoted as AjIkB and AjTollip, respectively). Both of these
factors share a remarkably high degree of structural conservation with their mammalian orthologs, such
Keywords:
Apostichopus japonicus
as a central ankyrin repeat domain (ARD) for the deduced amino acids of AjIkB and the C2 and CUE
Inhibitor of NF-kB domains for AjTollip. Constitutive expression patterns with differential expression levels were observed
Toll-interacting protein for these two genes. Moreover, mRNA transcript expression for AjIkB and AjTollip was highest in the
Vibrio splendidus tentacle and abundant in the muscle, respectively. Vibrio splendidus challenge study revealed that the
expression level of these two genes was decreased within the first 48 h with 0.53-fold and 0.61-fold
decrease compared with that in the control group for AjIkB and AjTollip, respectively. Taken together,
these results indicated that AjIkB and AjTollip functioned as negative regulators in the TLR cascade in
response to a V. splendidus challenge.
Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction Specific proteins may also hijack the TLR pathway to induce a
beneficial response of the appropriate magnitude and duration,
The innate immune system represents the first step in defense of which the inhibitor of NF-kB ((IkB) and Toll-interacting protein
against invading pathogens and relies on the presence of pattern (Tollip) have been best studied in some model organisms. In non-
recognition receptors (PRRs) to discriminate and eliminate path- stimulated cells, NF-kB is bound to the inhibitory protein, IkB.
ogens [1]. As one of the well established PRRs, the Toll-like re- Binding to IkB masks the nuclear localization signal (NLS) of NF-
ceptor (TLR) initiates a signaling cascade that activates the kB, cytoplasmically sequesters the NF-kB$IkB complex, and pre-
transcription factor nuclear factor kB (NF-kB) in a myeloid dif- vents NF-kB from binding to DNA [4]. When a pathogenic chal-
ferentiation factor 88 (MyD88)-dependent or MyD88- lenge occurs, the IkB kinase (IKK) phosphorylates IkB and
independent manner and regulates the expression of anti- degrades IkB, resulting in the release of NF-kB, enabling nuclear
microbial peptide (AMP) genes and numerous other molecules translocation [5]. Structurally, IkBs contain an N-terminal signal-
with immune function [2]. In deuterostomes, diverse TLRs have receiving domain (SRD), a central ankyrin repeat domain (ARD),
been demonstrated to recognize distinct pathogen-associated and a C-terminal proline-, glutamate-, serine-, and threonine-
molecular patterns (PAMPs) derived from various viruses, bacte- rich (PEST) sequence [4]. ARD binds to the Rel-homology
ria, protists, and fungi [3]. domain (RHD) and masks the nuclear localization signal (NLS)
of NF-kB [6]. In marine organisms, IkB homologs have been
identified in fish [7], shrimp [8], clam [9], scallop [10] and oyster
* Corresponding author. [11]. Furthermore, its role in bacterial or viral infection has also
E-mail address: [email protected] (C. Li). been investigated.

1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fsi.2013.08.014
1664 Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669

Tollip, a negative regulator of TLR signaling, was initially Table 1

discovered as an IL-1R1-interacting protein, which linked IL-1R- PCR primer sequences used in this study.

associated kinase (IRAK) to the IL-1 receptor pathway [12]. Subse- Primers Sequences (50 -30 ) Application
quently, this protein has also been shown to limit TLR2- and TLR4- AjIkB 3-1 CCATCTTGGTCAGCGACAAATCTA 30 RACE
mediated inflammatory responses and to restore immune system AjIkB 3-2 GAGAGCGACCGAGAGAGGATA
balance [12e14]. The regulatory role of Tollip is achieved by its AjIkB 5-1 TCAACAGTGTGTGGTTACGCC 50 RACE
structural characteristics. At its N-terminus, a TBD (Tom1-binding AjIkB 5-2 CGCCCAATCATCAAACGACTC
AjTollip 3-1 TGGTATCCACTCTCTGGGAAGCA 30 RACE
domain) mediates proteineprotein interactions and a unique pro-
AjTollip 3-2 CAGGCTGACCTCCAGAGCATCCA
tein kinase C conserved region 2 (C2) domain targets Tollip to the AjTollip 5-1 TTGGGTTCTTGGCTCCATTCATA 50 RACE
endosome [15,16]. In addition, a ubiquitin conjugation to ER AjTollip 5-2 GGTGTTTGTTGGTTTGTAGGTAC
degradation (CUE) domain located at the C-terminus mediates AjIkB F ACAGGAGTCGTTTGATGATTGG Real-time PCR
AjIkB R GTTTCTTCTTGTGTTTGGCGTTC
monoubiquitin binding [17]. These domains are thought to directly
AjTollip F GCCTGTGATGCCTATGATGTATGC Real-time PCR
interact with both the death and kinase domains of IRAK [18]. AjTollip R TGCTTGTTGCTGGACCTGTGGAG
Compared to other members of the TLR pathway, very little is AjActin F CCATTCAACCCTAAAGCCAACA Real-time PCR
known regarding Tollip, particularly in invertebrates. Gauthier et al. AjActin R ACACACCGTCTCCTGAGTCCAT
[19] identified Tollip using a genome search and expression Adapter dT30 GGCCACGCGTCGACTAGTACT(17) RACE adapter
Adapter dG50 GGCCACGCGTCGACTAGTACG(10)
sequence tags in the demo-sponge Amphimedon queenslandica.
During the preparation of this manuscript, the full-length cDNA of
Tollip was cloned from shrimp Litopenaeus vannamei and has been
shown to negatively regulate PEN4 in response to microbial in- 2.2. De novo assembly of the A. japonicus transcriptome
fections [20].
Skin ulcer syndrome (SUS) causes catastrophic losses to the sea A normalized coelomocyte cDNA library was constructed from
cucumber Apostichopus japonicus aquaculture, resulting in its healthy and diseased A. japonicus and sequenced using an Illumina
dramatically decreased reproduction in aquaculture [21]. Vibrio Hiseq2000 (unpublished data). Transcriptome de novo assembly
splendidus has been well documented as one of the major patho- was performed using the short-read assembly program Trinity. A
gens for this disease. Thus far, many studies have investigated the total of 52,680 distinct sequences matched known genes corre-
isolation and pathogenicity of pathogens [22]; however, how these sponding to 3893 annotated proteins, in which two unigenes of
pathogens modulate the host immune system via TLR cascades 447 bp and 784 bp were highly similar to known IkBs and Tollips,
remain largely unknown. Recently, two TLRs have been identified were employed for full-length cDNA cloning.
and characterized under various disease challenges by Sun et al.
[23]. However, the existence of other members in this signal 2.3. Cloning of full-length IkB and Tollip cDNAs from A. japonicus
pathway remains unknown in this species. In this study, we cloned
and characterized two negative regulators known as IkB and Tollip Total RNA was isolated from coelomocytes using TRIzol (Invi-
from the sea cucumber transcriptome. In addition, their spatial and trogen). First-strand cDNA synthesis was performed according to
temporal expression patterns were also examined. the Promega M-MLV RT Usage instructions using RQ1 RNase-Free
DNase (Promega)-treated total RNA (3 mg) as a template. The re-
actions were incubated at 42  C for 1 h and then terminated by
2. Materials and methods heating at 70  C for 10 min. Gene specific primers for AjIkB and
AjTollip (Table 1) were designed on the basis of the corresponding
2.1. Animals and challenge studies ESTs to clone each full-length cDNA according to RACE protocols.
The PCR products were then cloned into the pMD18-T simple vector
A. japonicus (165
23 g) were obtained from the Ningbo (TaKaRa) and sequenced bi-directionally using M13-47 and RV-M
Bowang Aquaculture Company. The animals acclimated for three primers. The sequencing results were confirmed and then sub-
days prior to the start of the experiment in 2.5% artificial seawater. jected to cluster analysis.
The temperature was maintained at 17
1  C for the entire
experiment. 2.4. Sequence analysis of AjIkB and AjTollip
V. splendidus was initially isolated from a skin ulceration disease
A. japonicus in our laboratory and inoculated into 2216E liquid The cDNA sequences of AjIkB and AjTollip were analyzed using
medium at 28  C with shaking at 220 rpm. The overnight cultures the BLAST algorithm at the National Centre for Biotechnology In-
was centrifuged at 5000 rpm for 10 min and then resuspended in formation (http://www.ncbi.nlm.nih.gov/blast), and the deduced
artificial seawater. For the challenge experiments, one tank served amino acid sequence was analyzed using the Expert Protein Anal-
as the control, and the other five tanks contained V. splendidus at a ysis System (http://www.expasy.org/). The percentages of similar-
high density, with a final concentration of 107 CFU mL1. To harvest ity and identity of full-length amino acid sequences between each
the coelomocytes, coelomic fluids were collected from individuals gene and its counterparts in other organisms were determined
in each tank at 0, 6, 24, 48, 72 and 96 h and then centrifuged at using the Identity and Similarity Analysis program (http://www.
1000 rpm for 5 min. We performed five replicates for each of the biosoft.net/sms/index.html). Multiple alignments of each protein
experimental groups as well as the control group. The samples were performed using the ClustalW Multiple Alignment program
were then stored at 80  C for RNA extraction and cDNA synthesis. (http://www.ebi.ac.uk/clustalw/) and the Multiple Align Show

Fig. 1. Alignment of the predicted amino acid sequences of IkBs. Identical residues in all of the sequences are represented in white font with a black background, while identical
residues among several sequences and conserved changes are shaded. The positions of the putative ANK and DnaJ are indicated with the red and blue border, respectively. The
alignment was made using the ClustalW program. Apostichopus japonicus (KF032816), Strongylocentrotus purpuratus (XP_791777.2), Oryzias latipes (XP_004074847.1), Oreochromis
niloticus (XP_003444423.1), Xenopus tropicalis (XP_002941348.1), Maylandia zebra (XP_004538228.1), Felis catus (XP_003985961.1), Ciona intestinalis (XP_002125694.1), Pan
troglodytes (BAE92777.1), Homo sapiens (NP_001138434.1), Crassostrea gigas (EKC41299.1). (For interpretation of the references to color in this figure legend, the reader is referred to
the web version of this article.)
Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669 1665
1666 Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669

Fig. 1. (continued).

program (http://www.biosoft.net/sms/index.html). Domains in the 3. Results and discussions

AjIkB and AjTollip amino acid sequence were detected using the
simple modular architecture research tool (SMART) program As a family of phylogenetically conserved proteins found in in-
(http://www.smart.emblheidelbergde/). sects, plants, and mammals, the TLR-mediated signaling pathway
has received increased attention for its role in innate immunity and
disease resistance compared to its original role in the formation of
2.5. Spatial expression analysis of AjIkB and AjTollip mRNA using
the dorsa-ventral axis in insects [18]. To depict the entire pathway
qPCR
in sea cucumber, two negative regulators of AjIkB and AjTollip were
identified and characterized in this study.
Total RNA was extracted from various tissues, including muscle,
tentacle, intestine, respiratory trees and coelomocytes, according to
3.1. cDNA cloning and analysis of the AjIkB and AjTollip genes
the manufacturer’s protocol, using TRIzol (Invitrogen), and cDNA
was generated as described in Section 2.3. The primers used for
Two nucleotide sequences of 1281 bp and 1335 bp, representing
qPCR are shown in Table 1. qPCR amplification was performed using
the full-length cDNA sequences of AjIkB and AjTollip, respectively,
a Rotor-Gene 6000 real-time PCR detection system. Real-time PCR
were obtained using overlapping ESTs and RACE fragments. These
amplifications were performed in a total volume of 20 mL con-
sequences were deposited in GenBank under the accession
taining 10 mL of 2  SYBR Green Mix (TaKaRa), 4 mL of the 1:20
numbers, KF032816 and KF032817.
diluted cDNA, 1 mL of each primer (10 mM) and 4 mL of PCR grade
The full-length cDNA of AjIkB consisted of a 50 UTR of 89 bp, a 3
water. The qPCR parameters included a denaturing step at 95  C for
‘UTR of 124 bp and a putative ORF of 1065 bp, which encoded a
10 min, followed by 40 cycles of 95  C for 15 s, 60  C for 20 s, 72  C
polypeptide of 355 amino acid residues. The predicted molecular
for 20 s. Melting analysis of the amplified products was performed
mass of the deduced amino acid of AjIkB was 41.39 kDa, and its
at the end of each PCR to confirm that a single PCR product was
theoretical pI was 8.76. SMART analysis indicated that AjIkB had
generated.
two conserved ankyrin repeat domains (ANK) (43 aa-72 aa; 77 aa-
114 aa) and a specific DnaJ domain (278 aa-348 aa) (Fig. 1, boxed).
2.6. Time-course analysis of AjIkB and AjTollip mRNA in response to The canonical PEST domain was replaced with a PGST in AjIkB
V. splendidus exposure (272 aa-275 aa) (Fig. 1, underlined). No conserved phosphorylation
site motif DS44RYSS48 sequence and lysine residue (K) for ubiq-
Coelomocytes were obtained to analyze the temporal expres- uitination were detected in the deduced amino acid of AjIkB.
sion profile of AjIkB and AjTollip when challenged by the Vibrio The full-length cDNA of AjTollip was 1335 bp and consisted of an
pathogen. RNA extraction, cDNA synthesis, and PCR were per- ORF of 906 bp, a 50 UTR of 105 bp, and a 30 UTR of 324 bp. The ORF
formed according to Section 2.5. The 2DDCT method was used to encoded a protein sequence of 302 amino acid residues with a
analyze the expression level of AjIkB and AjTollip, and the value predicted molecular mass of 33.5 kDa and theoretical pI of 5.11. The
obtained represented the n-fold difference relative to the control conserved domains of C2 and CUE were detected from 64 aa to
(untreated samples). The data were presented as the relative mRNA 160 aa and 262 aa to 301 aa, respectively (Fig. 2, boxed). However,
levels (means
S.D, n ¼ 5). The results were subjected to a one-way the conserved TBP domain, which is present in some mammals,
Analysis of Variance (ANOVA) followed by multiple Duncan’s tests was not present in the deduced amino acid sequence of AjTollip.
to determine the differences between the challenged and control
groups for each sampling time. Significant differences between the 3.2. Homology analysis of AjIkB and AjTollip
treated and corresponding control groups at each time point were
indicated with one asterisk for P < 0.05 and two asterisks for Protein sequences for IkBs (Fig. 1) and Tollips (Fig. 2) were
P < 0.01. aligned using the ClustalW program. The predicted amino acid
 Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669 1667

Fig. 2. Multiple sequence alignments of AjTollip with Tollips from other species. The full-length amino acid sequences of Tollips from typical organisms were aligned using the
ClustalX2.0 program (http://www.ebi.ac.uk/tools/clustalw2). The centrally localized C2 domain and C-terminal CUE domain are boxed with pink and blue lines, respectively.
Apostichopus japonicus (KF032817), Strongylocentrotus purpuratus (XP_787012.2), Felis catus (XP_003993842.1), Homo sapiens (NP_061882.2), Takifugu rubripes (XP_003978697.1),
Orcinus orca (XP_004278130.1), Ctenopharyngodon idella (AFM09715.1), Danio rerio (NP_996944.1), Gallus (NP_001006471.1), Oreochromis niloticus (XP_003459909.1), Saccoglossus
kowalevskii (XP_002736244.1). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
1668 Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669

Fig. 3. Spatial distribution of AjIkB and AjTollip revealed using qPCR.

sequence of AjIkB and AjTollip exhibited some homology to various isolated members of the Rel/NF-kB pathway, we demonstrated
known IkBs and Tollips, respectively. AjIkB shared a low homology diverse roles for this pathway in other organisms, including the sea
with other reported IkBs: 32% homology with Strongylocentrotus cucumber [24].
purpuratus (XP-791777), 31% homology with Oryzias latipes (XP-
004074847), and 30% homology with Oreochromis niloticus (XP- 3.4. Time course analysis of AjIkB and AjTollip expression after a
003444423) and Maylandia zebra (XP-004538228). However, bacterial challenge
higher identities were detected between AjTollip and its counter-
parts: a 61% identity was shown with Tollip from S. purpuratus (XP- It has been well documented that pathogenic infections activate
787012), a 52% identity was shown with Odobenus rosmarus the immune response, including the TLR-mediated signaling
divergens (XP-00403841), a 30% identity was shown with Felis catus cascade [25]. Previous studies have shown that V. splendidus is one
(003993842), and a 50% identity was shown with Takifugu rubripes of the major pathogens for skin ulceration syndrome [26,27]. In
(XP-0039778697). addition, invertebrate hemocytes have been demonstrated to play
an important role in limiting infection and have been used to
3.3. Tissue expression patterns of AjIkB and AjTollip investigate the fluctuation of immune-related genes [28]. Thus, the
temporal expression of AjIkB and AjTollip transcripts after a
The spatial mRNA expression levels of AjIkB and AjTollip are V. splendidus challenge is shown in Fig. 4. The expression levels of
shown in Fig. 3. Transcripts for these two genes were observed in all AjIkB and AjTollip were downregulated after 6 h and reached their
examined tissues with different expression patterns. Tissue distri- lowest expression at 48 h, which was a 0.53-fold (P < 0.01) and
bution revealed a higher expression pattern of AjIkB mRNA tran- 0.61-fold decrease, respectively, compared to the control group
scripts in the tentacle; however, AjTollip mRNA transcripts were (Fig. 4). Furthermore, distinct expression patterns were detected
most abundant in the muscle. between the two genes. The level of AjIkB transcripts steadily
Previous studies have also shown Tollip and IkB to be consti- increased and was restored to the level of the control group within
tutively expressed in different tissues in a variety of organisms. For 96 h. However, a second downregulation of the AjTollip expression
example, the peak expression of shrimp Tollip was detected in pattern was found after 72 h, and the lowest expression level was
muscle [20], and the peak expression of IkB was detected in he- detected at 96 h with a 0.44-fold decrease compared to the control
mocytes in shrimp [8] and clam [9]. However, IkB was mainly group (P < 0.05).
identified in hepatopancreas in scallop [10]. In some vertebrates, The observed expression of AjTollip and AjIkB were consistent
tissue-specific expression of IkBs was also reported, which might be with an upregulation of AjToll expression in the same tissue [23]
attributed to its various isoforms and broad spectrum of activity. and a negative regulatory function of mammalian Tollip and IkB
Consistent with the tissue expression analysis of previously [18]. Taken together, these results could be interpreted that AjTollip

Fig. 4. Time-course expression profiles of AjIkB and AjTollip in coelomocytes challenged with Vibrio splendidus at 0, 6, 24, 48, 72 and 96 h.
 Y. Lu et al. / Fish & Shellfish Immunology 35 (2013) 1663e1669 1669

and AjkB served as an indicator for the activation of the Toll [6] Baeuerle PA, Henkel T. Function and activation of NF-kappa B in the immune
system. Annu Rev Immunol 1994;12:141e79.
signaling pathway in sea cucumber in response to gram-negative
[7] Sangrador-Vegas A, Smith TJ, Cairns MT. Cloning and characterization of a
bacterial infection. Bacterial infection inhibited the transcriptional homologue of the alpha inhibitor of NF-kB in rainbow trout (Oncorhynchus
level of IkB in scallop [10]. Furthermore, different expression pro- mykiss). Vet Immunol Immunopathol 2005;103:1e7.
files were found in clam [9], oyster [11] and shrimp [8]. However, [8] Arockiaraj J, Avin FA, Vanaraja P, Easwvaran S, Singh A, Othman RY, et al.
Immune role of MrNFkBI-a, an IkB family member characterized in prawn
the mechanisms underlying the different expression profiles for IkB M. rosenbergii. Fish Shellfish Immunol 2012;33:619e25.
may involve the multiple roles of IkB in different biological pro- [9] Yang Q, Yang Z, Li H. Molecular characterization and expression analysis of an
cesses. For the expression patterns of AjTollip, limited information inhibitor of NF-kB (IkB) from Asiatic hard clam Meretrix meretrix. Fish Shellfish
Immunol 2011;31:485e90.
was available in response to a bacterial challenge. Moreover, its [10] Mu C, Yu Y, Zhao J, Wang L, Song X, Zhang H, et al. An inhibitor kB homologue
association with viral infection has only been investigated in some from bay scallop Argopecten irradians. Fish Shellfish Immunol 2010;28:687e94.
fishes and shrimp, and these studies found that Tollips were [11] Zhang Y, He X, Yu Z. Two homologues of inhibitor of NF-kappa B (IkB) are
involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish
upregulated in most immune-related tissues in a time-dependent Shellfish Immunol 2011;30:1354e61.
manner [20,25,29], which was attributed to a balance between [12] Burns K, Clatworthy J, Martin L, Martinon F, Plumpton C, Maschera B, et al.
the activation of the TLR pathway and the infection-related pro- Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 re-
ceptor. Nat Cell Biol 2000;2:346e51.
inflammatory activation of the innate immune cascade. Thus, the [13] Li T, Hu J, Li L. Characterization of Tollip protein upon lipopolysaccharide
differential expression patterns found in response to bacterial and challenge. Mol Immunol 2004;41:85e92.
viral challenges were associated with its functional differentiation. [14] Song Z, Yin J, Yao C, Sun Z, Shao M, Zhang Y, et al. Variants in the Toll-
interacting protein gene are associated with susceptibility to sepsis in the
In higher animals and in the fruit fly, each TLR can detect distinct
Chinese Han population. Crit Care 2011;15(1):R12.
PAMPs derived from viruses, bacteria, mycobacterium, fungi, and [15] Ankem G, Mitra S, Sun F, Moreno AC, Chutvirasakul B, Azurmendi HF. The C2
parasites [30], of which TLR4 recognizes LPS and TLR3, 7, 8, and 9, domain of Tollip, a Toll-like receptor signalling regulator, exhibits broad
which participate in viral infection [31]. preference for phosphoinositides. Biochem J 2011;435:597e608.
[16] Rebl A, Rebl H, Liu S, Goldammer T, Seyfert H. Salmonid Tollip and MyD88
factors can functionally replace their mammalian orthologues in TLR-
4. Conclusion mediated trout SAA promoter activation. Dev Comp Immunol 2011;35:81e7.
[17] Capelluto DGS. Tollip: a multitasking protein in innate immunity and protein
trafficking. Microbes Infect 2012;14:140e7.
Taken together, our results indicated that AjTollip and AjIkB [18] Zhang G, Ghosh S. Negative regulation of toll-like receptor-mediated signaling
serve as negative regulators in the ancient TLR-mediated activation by Tollip. J Biol Chem 2002;277(9):7059e65.
[19] Gauthier MEA, Pasquier LD, Degnan BM. The genome of the sponge Amphi-
cascade in sea cucumber. However, further studies are required to medon queenslandica provides new perspectives into the origin of Toll-like
identify and characterize additional components of this signaling and interleukin 1 receptor pathways. Evol Dev 2010;12:519e33.
pathway in this species and to investigate additional proteins that [20] Wang P, Gu Z, Wan D, Zhu W, Qiu W, Chen Y, et al. Litopenaeus vannamei Toll-
interacting protein (LvTollip) is a potential negative regulator of the shrimp
interact with AjTollip, such as specific TLRs and the homology of IL- Toll pathway involved in the regulation of the shrimp antimicrobial peptide
1 receptor-associated kinase (IRAK). gene penaeidin-4 (PEN4). Dev Comp Immunol 2013;40(3e4):266e77.
[21] Dong Y, Deng H, Sui X, Song L. Ulcer disease of farmed sea cucumber (Apos-
tichopus japonicus). Fish Sci 2005;24:4e6 [In Chinese].
Acknowledgments [22] Li C, Feng W, Qiu L, Xia C, Su X, Jin C, et al. Characterization of skin ulceration
syndrome associated microRNAs in sea cucumber Apostichopus japonicus by
deep sequencing. Fish Shellfish Immunol 2012;33:436e41.
This study was financially supported by NSFC (31101919,
[23] Sun H, Zhou Z, Dong Y, Yang A, Jiang B, Gao S, et al. Identification and
41276120), the Spark Program of the State Ministry (2011GA701019), expression analysis of two Toll-like receptor genes from sea cucumber
Natural Science Foundation of Ningbo (2011A61003, 2011C11001), the (Apostichopus japonicus). Fish Shellfish Immunol 2013;34:147e58.
Outstanding (Postgraduate) Dissertation Growth Foundation of [24] Montagnani C, Labreuche Y, Escoubas JM. Cg-IjB, a new member of the IjB
protein family characterized in the pacific oyster Crassostrea gigas. Dev Comp
Ningbo University (PY2012005), and the K.C. Wong Magna Fund at Immunol 2008;32:182e90.
Ningbo University. [25] Rebl A, Høyheim B, Fischer U, Köllner B, Siegl E, Seyfert H. Tollip, a negative
regulator of TLR-signalling, is encoded by twin genes in salmonid fish. Fish
Shellfish Immunol 2008;25:153e62.
References [26] Deng H, He C, Zhou Z, Liu C, Tan K, Wang N, et al. Isolation and pathogenicity
of pathogens from skin ulceration disease and viscera ejection syndrome of
[1] Bulut Y, Faure E, Thomas L, Equils O, Arditi M. Cooperation of Toll-like receptor the sea cucumber Apostichopus japonicus. Aquaculture 2009;287:18e27.
and 6 for cellular activation by soluble tuberculosis factor and Borrelia burg- [27] Zhang C, Wang Y, Rong X. Isolation and identification of causative pathogen
dorferi outer surface protein a lipoprotein: role of toll-interacting protein and for skin ulcerative syndrome in Apostichopus japonicus. J Fish China 2006;30:
IL-1 receptor signaling molecules in Toll-like receptor 2 signaling. J Immunol 118e23 [In Chinese].
2001;167:987e94. [28] Zhang L, Zhao J, Li C, Su X, Chen A, Li T, et al. Cloning and characterization of
[2] Thoetkiattikul H, Beck MH, Strand MR. Inhibitor kappaB-like proteins from a allograft inflammatory factor-1 (AIF-1) from manila clam Venerupis philip-
polydnavirus inhibit NF-kappaB activation and suppress the insect immune pinarum. Fish Shellfish Immunol 2011;30(1):148e53.
response. Proc Natl Acad Sci USA 2005;102(32):11426e31. [29] Huang R, Lv J, Luo D, Liao L, Zhu Z, Wang Y. Identification, characterization and
[3] Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol the interaction of Tollip and IRAK-1 in grass carp (Ctenopharyngodon idellus).
Med 2007;13:460e9. Fish Shellfish Immunol 2012;33:459e67.
[4] Napetschnig J, Wu H. Molecular basis of NF-kB signaling. Annu Rev Biophys [30] Kawai T, Akira S. Toll-like receptors and their crosstalk with other innate
2013;42:443e68. receptors in infection and immunity. Immunity 2011;34:637e50.
[5] Solt L, May M. The IkB kinase complex: master regulator of NF-kB signaling. [31] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity.
Immunol Res 2008:18. Cell 2006;124:783e801.