Article

Effects of Feed Additives (Nannochloropsis gaditana and

Hermetia illucens) on Growth and Expression of Antioxidant and
Cytokine Genes in Nile Tilapia (Oreochromis niloticus)
Subjected to Air Exposure Stress
László Ardó 1 , Zsuzsanna J. Sándor 1, * , Márton Orbán 2 , János Szakáli 3 , Janka Biró 1 , Anita Annamária Szűcs 1 ,
Gyula Kovács 1 , Michelle Lévai 4 , Balázs Gregosits 2 , Zsuzsanna Brlás-Molnár 1 and Emese Békefi 1

1 Research Centre for Fisheries and Aquaculture, Hungarian University of Agricultural and Life
Sciences (MATE), Anna Liget. u. 35, 5540 Szarvas, Hungary; [email protected] (L.A.);
[email protected] (J.B.); [email protected] (A.A.S.);
[email protected] (G.K.); [email protected] (Z.B.-M.);
[email protected] (E.B.)
2 Vitafort First Hungarian Feed Production and Distribution Zrt., Szabadság u. 3., 2370 Dabas, Hungary;
[email protected] (M.O.); [email protected] (B.G.)
3 Vitafort Agro Asia Zrt., Szabadság u. 3., 2370 Dabas, Hungary; [email protected]
4 ADC Aquatic Development Company Ltd., AngNamHoum Village, Naxaything District,
Vientiane 0114, Laos; [email protected]
* Correspondence: [email protected]

Simple Summary: Over the past 20 years, the production of Nile tilapia (Oreochromis
niloticus) has grown rapidly in Laos, accounting for over 38% of the country’s total finfish
aquaculture production. With the intensification of aquaculture, there has been increasing
interest in the use of plants, herbs, and algae as immunostimulants in fish diets. In this
study, the impact of different feed additives was examined on juvenile fish reared in cages
Academic Editors: Xiuzhen Sheng
over a 7-week feeding period. The fish were fed with four different types of diets and
and Ravi Fotedar
subsequently subjected to air exposure. Overall, both feed additives supported the fish in
Received: 1 May 2025
coping with air exposure stress during farming.
Revised: 10 June 2025
Accepted: 13 June 2025
Abstract: A 7-week feeding trial was conducted with Nile tilapia juveniles with an average
Published: 17 June 2025
body weight of 143.5 ± 3.1 g in a cage system in order to test the effect of different feed
Citation: Ardó, L.; Sándor, Z.J.;
additives on growth performance, antioxidant defense system, and immune status of
Orbán, M.; Szakáli, J.; Biró, J.; Szűcs,
A.A.; Kovács, G.; Lévai, M.; Gregosits,
fish. For this reason, experimental diets were formulated with inclusion of two different
B.; Brlás-Molnár, Z.; et al. Effects of additives containing bioactive compounds, namely Nannochlorophsis gaditana in 3.5% (diet
Feed Additives (Nannochloropsis EXP-A) and black soldier fly larvae meal (diet EXP-I) in 3.5%, and compared with a diet
gaditana and Hermetia illucens) on supplemented with a mixture of two different commercial compounds (Yang and Syrena
Growth and Expression of
Boost) in 0.4% (diet EXP-S). As a negative control, a commercially available feed (Nongteng,
Antioxidant and Cytokine Genes in
Laos) for tilapia was selected. At the end of the feeding trial, production parameters
Nile Tilapia (Oreochromis niloticus)
Subjected to Air Exposure Stress.
and expression of genes related to the antioxidant defense system and innate immune
Animals 2025, 15, 1776. https:// response were studied. Furthermore, following the feeding, air exposure stress for 5 min
doi.org/10.3390/ani15121776 was administered to the fish, and similar parameters were assessed. Results indicated that
Copyright: © 2025 by the authors.
all diets promoted adequate fish growth (SGR 1.67–1.81 g day−1 ) and feed utilization (FCR
Licensee MDPI, Basel, Switzerland. 1.29–1.57 g g−1 ) with no significant (p < 0.05) differences in these parameters between the
This article is an open access article dietary fish groups. Expression of genes sod, cat, and gpx significantly increased in the liver
distributed under the terms and samples of the EXP-A group at the end of feeding. Following air exposure, the EXP-A group
conditions of the Creative Commons
maintained a significantly higher level of antioxidant-related gene expression compared to
Attribution (CC BY) license
other treatments. Subsequently, gpx upregulation was observed in the EXP-S group in the
(https://creativecommons.org/
licenses/by/4.0/).
post-stress stage compared to pre-stress. Based on our results, we recommend the inclusion

Animals 2025, 15, 1776 https://doi.org/10.3390/ani15121776

Animals 2025, 15, 1776 2 of 15

of any of the tested additives at the evaluated doses to enhance the non-specific immune
response of Nile tilapia. Additionally, Nannochloropsis gaditana at a 3.5% inclusion level can
be used to further improve antioxidant defense capacity.

Keywords: stress; additives; Hermetia illucens; Nannochloropsis; gene expression

1. Introduction
Although Laos is a landlocked country, it possesses abundant freshwater resources
that are well-suited for fish farming. However, its geographical location significantly differ-
entiates the structure of its fisheries and aquaculture from that of neighboring countries
with access to the sea. Capture fisheries and aquaculture are of great importance in the
employment of rural communities and nutrition of the people living in the countryside.
Annual fish consumption per capita exceeds 25 kg, which makes Laos one of the world’s
leading fish-consuming countries. For a long time, carps (common carp, Chinese carps,
and Indian major carps) were dominant in Lao fish production, but in the last 20 years, the
production of Nile tilapia (Oreochromis niloticus) has developed rapidly. Tilapia production
reached 55,260 tons in 2022, which makes up 38% of the total finfish aquaculture production
based on the dataset from FAO FishStatJ [1].
In parallel with the expansion and intensification of the aquaculture sector in Laos,
it has been highlighted that the feed sector requires more specialized functional feeds
to protect fish from diseases. Functional feeds in aquaculture are specially formulated
diets designed not only to meet the basic nutritional requirements of aquatic species
but also to promote health, enhance growth performance, and improve resistance to
stress and diseases. These feeds often include additives such as probiotics, prebiotics,
immunostimulants, plant extracts, carotenoids, β-glucans, or essential fatty acids. By
supporting the immune system and overall well-being of farmed species, functional feeds
contribute to more sustainable and productive aquaculture practices [2,3]. Microalgae of
the genus Nannochloropsis are characterized by a high content of polyunsaturated fatty
acids (PUFAs), carotenoids, vitamins, and polyphenols [4], besides their advantageous
protein (22.2–45%) and lipid content (15.1–45%) [5,6]. Several studies focused on its impact
on the non-specific immune system of Nile tilapia. For instance, dietary supplementation
of Nannochloropsis oculata beneficially affected the innate immune parameters and immune-
related gene expression [7]. These effects were also observable following an air exposure
stress. In further studies, the enhancement of growth performance, feed utilization, serum
biochemical indices, antioxidant activities, and immune response of Nile tilapia due to the
N. oculata supplementation was also reported [8,9]. Similar positive effects of N. gaditana
inclusion in the diet were described in gilthead seabream [10,11].
Based on the above-mentioned promising characteristics of Nannochlorophsis genus,
in the frame of iFishienci project it was aimed to select several strains of various biomass
sources at Norwegian Research Centre (photoautotrophic microalgae, fungi, heterotrophic
microalgae) regarding their nutritional values (especially protein, total fatty acid, and
omega-3 fatty acid content) or antioxidant capacities and produce it at high scale for dietary
inclusion for animals. Finally, biomass (more than 17 kg dry weight) of photoautotrophic
microalgae Nannochloropsis gaditana CCMP526 was produced and partly utilized in the
preparation of the experimental feed EXP-A.
Black soldier fly larvae (BSFL) (Hermetia illucens) meal has a good nutritional profile
in terms of vitamins, minerals, nucleotides [12], and bioactive compounds [13]. BSFL
meal supplementation positively affected the health status of fish in several species, such
Animals 2025, 15, 1776 3 of 15

as rainbow trout (Oncorhynchus mykiss) [14], European seabass (Dicentrarchus labrax) [15],
yellow catfish (Pelteobagrus fulvidraco) [16], and marron (Cherrax cainii) [17]. In Nile tilapia,
BSFL meals stimulated innate immunity by increasing lysozyme activity [18,19]. Enhanced
immunity due to improved lysozyme and peroxidase activities in the skin mucus of
Nile tilapia fed 4% and 6% BSFL meal was also observed [20]. However, except for the
above-mentioned publications, only a few studies focused on the effect of BSFL as an
immunostimulant in the case of Nile tilapia.
Our primary aim was to emphasize the importance of using formulated feeds supple-
mented with additives to boost aquaculture productivity. According to this, the objective
of this study was to compare the effects of dietary inclusion of N. gaditana meal CCMP256,
defatted black soldier fly larvae meal, and a mix of two commercially available feed addi-
tives on production traits, antioxidant defense system, innate immune response, and stress
tolerance of intensively reared Nile tilapia. In order to achieve this goal, juvenile fish were
fed with different diets, and finally, an air exposure stress was administered.

2. Materials and Methods

2.1. Experimental Design and Fish Husbandry
The location and infrastructure for the implementation of the experiment were pro-
vided by Aquatic Development Company in Vientiane, Laos, where 1000 individuals of a
monosex batch of Nile tilapia hybrids produced by the combination of GIFT (Genetically
Improved Farmed Tilapia) and Big Nin strains, with approx. 100 g body weight was set
up for the feeding trial. The 2-week-long habituation period started on 20 August 2021.
Two cage systems were installed in the same lake, and each system consisted of four cages
with a 45 m3 volume per cage. The water supply of the lake was provided by the Namhoum
reservoir. Fish stock was allocated into eight groups; the treatments were applied in du-
plicates. According to the experimental design, 120 fish were accommodated in one unit
(Figure 1). The stocking density was set lower than that typically used in commercial
conditions to promote intensive weight gain. Furthermore, the limited availability of the
tested N. gaditana meal imposed constraints on feed production and decreased the number
of fish involved in the nutritional trial.

Figure 1. Experimental and sampling design. COM: Nile tilapia commercial feed (control group);
EXP-S: experimental feed supplemented with a mixture of two commercially available feed additives
(Yang and Syrena Boost) in 0.4%; EXP-I: experimental feed supplemented with 3.5% black soldier fly
larvae meal; EXP-A: experimental feed supplemented with 3.5% N. gaditana.
Animals 2025, 15, 1776 4 of 15

The feeding trial lasted 7 weeks and ended on 22 October 2021. On the second week
of the habituation, as part of the iFishienci project activity, the iBOSS system (with the
new sensor) was installed by the online support of Bioceanor (Valbonne, France). The
following parameters were recorded by the instrument to the server every 20 min: O2 level,
pH, temperature, and conductivity. The O2 saturation fluctuated between 41.5 and 66.6%
with an average value of 55.9 ± 9.6%. The pH level was 6.2 ± 0.31, while the temperature
was almost constant at 31.3 ± 0.6 ◦ C. For the conductivity of water, 34.1 ± 0.63 µS/cm
was measured. The feed was offered twice a day, and the daily ratio was set to 3.0% of
total biomass in the first week, with the ratio decreasing during the trial according to the
growth of fish (Table 1). To determine the weekly weight gain and to check the general
health conditions of the population, the fish were measured on a weekly basis. During
the sampling, the length and weight of fish (15 fish/cage) were recorded by every feeding
group to provide data for the calculation of production performance indicators.

Table 1. Feeding rate (% of total biomass) during the trial.

Weeks 1. 2. 3. 4. 5. 6. 7.
feeding rate % 3 2.5 2.5 2 2 2 2

2.2. Ethical Issues

All procedures involving fish were conducted in accordance with the Law on Animal
Husbandry and Veterinary (Revised) No. 08/NA, dated 11 November 2016, of the Lao
People’s Democratic Republic. All efforts were made to minimize the suffering of the fish.

2.3. Feed Preparation

Three experimental diets were formulated as follows: treatment EXP-A, feed sup-
plemented with 3.5% N. gaditana; treatment EXP-I, feed supplemented with 3.5% black
soldier fly larvae meal; treatment EXP-S, feed supplemented with bioactive compounds
in 0.4%. The last one was a mixture of commercially available feed additives, Yang (Lalle-
mand, France) and Syrena Boost (Delacon Biotechnik, Engerwitzdorf, Austria), possessing
high technological adaptability and good physiological effects. By this construction the
performance of the fish fed with algae and insect protein supplemented feeds could be
compared not just with the commercial feed used for Nile tilapia (treatment COM) but
with a group offered a feed containing commercially available bioactive additives. The
experimental diets were set to iso-nitrogenous and iso-energetic. The feeds were produced
by Nongteng feed mill (Chansavang Village, Sikhottabong District, Vientiane Capital, Laos).
The formulation, proximate, and calculated chemical composition of the diets are presented
in Table 2.

Table 2. Formulation and proximate composition of diets.

Ingredients COM EXP-S EXP-I EXP-A

Fish meal-60 (Thailand) 40 53.5 50.8 53
Soybean meal-46 (Thailand) 36 18 18 16
Casava leaf (Laos) 8 12.4 12 12
Corn (Laos) 7 7 7 6.5
Rice brain (Laos) 6 5.7 5.7 6
Premix (Hungary) 1 3 3 3 3
Alga meal (Norway) 2 0 0 0 3.5
Black soldier fly meal (Laos) 0 0 3.5 0
Bioactive compound (Austria and France) 3 0 0.4 0 0
Animals 2025, 15, 1776 5 of 15

Table 2. Cont.

Ingredients COM EXP-S EXP-I EXP-A

Proximate composition of the diets (%, as is)
Water content 9.5 6.7 6.8 6.5
Crude protein 37.0 36.8 36.1 37.5
Crude fat 3.19 3.05 2.66 3.02
Ca 3.06 3.21 3.21 3.21
P 1.73 1.65 1.62 1.72
1 Vitafort Zrt. (Dabas, Hungary) with product number 222-374-65; 2 Nannochloropsis gaditana: produced by NORCE
(Norwegian Research Centre) for research purposes; 3 Mixture of Yang product (Lallemand, Blagnac, France)
and Syrena Boost product (Delacon Biotechnik, Engerwitzdorf, Austria) with 1 g/kg and 200 mg/kg doses,
respectively; COM: commercial feed; EXP-S-diet supplemented with bioactive material; EXP-I-diet supplemented
with black soldier fly meal; EXP-A-diet supplemented with N. gaditana.

2.4. Chemical Analysis of the Diets

The chemical composition of the feeds was analyzed by standard Hungarian and
AOAC methods as follows: the crude protein was determined with the Dumas method
based on Hungarian MSZ EN ISO 16634-1:2009 [21] regulation using Rapid N Cube nitro-
gen/protein analyzer (Elementar Analysensysteme GmbH, Langenselbold, Germany).
The crude fat was determined according to the AOAC 945.16 based on the Soxhlet method
using an automatic system (SOXTHERM® Unit SOX416, Gerhardt, Germany) and diethyl
ether (boiling point, 40–60 ◦ C) as a solvent. For Ca and P determination, the Hungarian
standard method MTK 2004 III. 12. was applied, when the samples were incinerated at
550 ◦ C, the residual ash was digested in 10% hydrochloric acid and used after dilution to
set the calibration range. The measurements were performed on an inductively coupled
plasma optical emission spectrometer (iCAP 7400, Thermo Fischer Scientific, Waltham,
MA, USA).

2.5. Sampling and Air Exposure Stress

At the end of the 7-week feeding experiment trial, expression of genes involved in
growth, non-specific immune response and antioxidant defense system of the fish were
studied. For this reason, liver and head kidney samples were collected from six fish per
treatment (24 individuals altogether). Fish after 24 h of feed deprivation were anesthetized
with an overdose of clove oil, and 100 mg of head kidney and liver samples were placed
into 1 mL of RNAlater reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA)
for 1 day at 4 ◦ C, followed by storage at −20 ◦ C. After the feeding experiment, six fish
per treatment (24 individuals altogether) were netted out of the cages and exposed to
air for 5 min. There is no referred, specific protocol for conducting air exposure stress
experiments with tilapias. Therefore, the exposure time was selected according to data
in the literature. In a similar experiment [7], 1 min was applied, and 5 min was regarded
as adequate, because tilapias can survive on air for much longer times [22,23]. After this
period, all 24 stressed fish were immediately put back into water and over-anesthetized
with clove oil. Head kidney and liver samples were taken from all 24 fish. The detailed
structure of the feeding and stress experiment is presented in Figure 1.

2.6. Growth Parameters

In order to determine the growth performance and nutrient utilization of the fish, the
following parameters were measured and calculated at the end of the trial:
Specific Growth Rate (g/day), SGR = 100 × (ln FBW − ln IBW)/t
FBW = final average weight at the end of the experiment (g)
IBW = initial average weight at the beginning of the experiment (g)
Animals 2025, 15, 1776 6 of 15

t = experimental time in days

Weight gain (g), WG = FBW − IBW
Condition factor (g cm−3 ), CF = 100 × FBW/L3
L—total body length at the end of the trial
Feed conversion ratio (g/g), FCR = total amount of feed given (g)/final total body weight
− initial total body weight (g)
Specific Feed Cost (€kg−1 fish) = feed cost × FCR

2.7. Analysis of Gene Expression

The liver and head kidney samples were transported to the laboratories of the Research
Institute of Fisheries and Aquaculture of MATE, Hungary, in order to perform the analysis.
During the transport, the samples were kept below 4 ◦ C, and after arriving at the labora-
tory site, they were stored at −20 ◦ C until the analysis. Total RNA was isolated from the
samples using the Aurum Total RNA Mini kit (Bio-Rad, Hercules, CA, USA), according to
the manufacturer’s instructions. Concentration and purity of RNA were measured using
a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), while the
quality of the RNA was checked with agarose gel electrophoresis. A total of 400 ng of mRNA
from each sample was reverse transcribed into cDNA using the qPCRBIO cDNA Synthesis
kit (PCR Biosystems, London, UK). cDNAs were analyzed in real-time quantitative PCR
(qPCR) reactions. These reactions were run in triplicate, using a LightCycler 96 instrument
(Roche, Basel, Switzerland) and the Luna Universal qPCR Master Mix (New England Biolabs,
Ipswich, MA, USA). Expression of genes related to oxidative stress response (sod, cat, gpx)
and growth (igf-1) was measured from liver samples, whereas expression of genes related to
innate immune response (tnf-α, il-1β, il-8, ifn-γ) was measured from head kidney samples. 18S
rRNA was used as a reference gene. The primers used are presented in Table 3. The qPCR
reaction was carried out in a final volume of 20 µL consisting of 10 µL of master mix (2×),
1 µL of each primer (10 µM), 5 µL of cDNA (reverse transcription reaction mix), and 3 µL of
nuclease-free water. The thermal profile for all reactions was 95 ◦ C for 10 min, followed by
45 cycles at 95 ◦ C for 15 s, and 60 ◦ C for 30 s. The specificity of the reactions was checked by
melting curve analysis, and no mispriming or primer dimers were found. The mean threshold
cycle (Ct) values were calculated, and the qPCR data were analyzed by the 2−∆∆Ct method
described by Livak and Schmittgen [24]. The efficiencies of qPCR reactions were determined
using standard curves, and serial dilutions were made from cDNAs of a liver and a head
kidney sample. These cDNAs were diluted to 10×, 30×, 90×, 270×, and 810×. Quantitative
PCR reactions were carried out on these dilutions with all primer pairs in triplicate. Standard
curves were drawn for each primer pair by plotting Ct values against the log10 of different
dilutions of cDNA sample solutions. Efficiencies (E) were calculated from the slopes of the
standard curves using the equation E = 10(−1/slope), and the results are shown in Table 3.

Table 3. Primers used for real-time quantitative PCR.

Target Gene Forward Primer Reverse Primer Efficiency Reference

sod GACGTGACAACACAGGTTGC TACAGCCACCGTAACAGCAG 2.02 [25]
cat TCAGCACAGAAGACACAGACA GACCATTCCTCCACTCCAGAT 2.00 [25]
gpx CCAAGAGAACTGCAAGAACGA CAGGACACGTCATTCCTACAC 2.03 [25]
igf-1 GTTTGTCTGTGGAGAGCGAGG GAAGCAGCACTCGTCCAGG 2.02 [26]
tnf-α GAGGTCGGCGTGCCAAGA TGGTTTCCGTCCACAGCGT 2.10 [25]
il-1β TGCTGAGCACAGAATTCCAG GCTGTGGAGAAGAACCAAGC 1.86 [25]
il-8 GCACTGCCCGCTGCATTAAG GCAGTGGGAGTTGGGAAGAA 2.03 [25]
ifn-γ TGACCACATCGTTCAGAGCA GGCGACCTTTAGCCTTTGT 2.01 [25]
18S GTGCATGGCCGTTCTTAGTT CTCAATCTCGTGTGGCTGAA 1.98 [27]
sod: superoxide dismutase; cat: catalase; gpx: glutathione peroxidase; igf-1: insulin-like growth factor 1; tnf-α:
tumor necrosis factor alpha; il-1β: interleukin 1 beta; il-8: interleukin-8; ifn-γ: interferon gamma; 18S: 18S rRNA.
Animals 2025, 15, 1776 7 of 15

2.8. Statistical Analysis

Growth data were statistically processed by one-way analysis of variance (ANOVA)
followed by Tukey Multiple Comparison Test (p < 0.05) using the SPSS software version
22 (IBM Corp, Armonk, NY, USA). The significant differences were considered at p < 0.05.
The Kolmogorov-Smirnov test was used to assess normality. The homogeneity of the
variances was checked by the Tukey HSD test. Gene expression data were analyzed and
figures were drawn using SigmaPlot version 12.0 (Systat Software). Normality of data
and homogeneity of variances were checked using the Shapiro-Wilk and Tukey HSD tests,
respectively. Differences between experimental groups before and after air exposure were
analyzed by one-way ANOVA, followed by Student–Newman–Keuls test, whereas an
independent samples t-test was used to determine the differences between samples taken
before and after the air exposure in each experimental group. In both cases, the differences
were considered significant at p < 0.05.

3. Results
3.1. Growth Performance
The growth performance of Nile tilapia is summarized in Table 4. During the 7-week
trial, the fish increased their body weight by almost 2.5 times with a specific growth rate
(SGR) between 1.67 and 1.84 g day−1 . Feed conversion rate varied between 1.29 and 1.57.
The detected mortality was not higher than 7.1% (the survival rate was higher than 92.9%).
According to the statistical analysis performed, no significant differences were detected
among any of the treatments in the production and nutrient utilization parameters, survival
rate, and condition factor of the fish. The specific feed cost (feed cost per unit of weight
gain) calculated for each treatment showed a slight increase with the inclusion of additives,
with the highest cost observed in the diet supplemented with N. gaditana.

Table 4. Growth performance of Nile tilapia (n = 240 fish/group, mean ± SD).

Treatments COM EXP-S EXP-I EXP-A p-Value

IBW (g) 147.8 ± 2.1 144.0 ± 1.4 140.2 ± 15.8 142.5 ± 2.1 0.863
FBW (g) 337.5 ± 68.6 344.5 ± 21.9 344.0 ± 28.3 348.0 ± 46.7 0.994
SGR (gday−1 ) 1.67 ± 0.30 1.78 ± 0.11 1.84 ± 0.1 1.81 ± 0.03 0.845
WG (g) 190.0 ± 59.4 200.5 ± 20.5 204 ± 12.7 205.5 ± 48.8 0.489
FCR (gg−1 ) 1.57 ± 0.54 1.38 ± 0.04 1.29 ± 0.15 1.45 ± 0.49 0.875
SR (%) 94.6 ± 0.6 96.3 ± 1.8 96.3 ± 1.8 92.9 ± 0.6 0.150
CF (gcm−3 ) 3.80 ± 0.32 3.87 ± 0.33 4.27 ± 0.02 3.99 ± 0.32 0.435
Feed Cost (€/kg) 0.77 0.88 0.95 0.95 NR
Specific Feed Cost
1.21 ± 0.15 1.21 ± 0.03 1.23 ± 0.07 1.26 ± 0.09 0.547
(€/kg fish)
IBW: initial average body weight; FBW: average final body weight; WG: weight gain; SGR: specific growth
rate; FCR: feed conversion ratio; SR: survival rate; CF: condition factor; COM: commercial feed; EXP-S: diet
supplemented with bioactive material; EXP-I: diet supplemented with black soldier fly meal; EXP-A: diet
supplemented with N. gaditana; NR: not relevant.

3.2. Expression of Genes Related to Growth, Stress, and Immune Response

At the end of the feeding experiment, the expression levels of genes involved in the
antioxidant defense system (sod, cat, gpx) significantly (p < 0.05) increased in liver samples of
group EXP-A, compared to the other groups (Figure 2a–c). However, the expression of igf-1,
a gene controlling growth, was not significantly different among the groups (Figure 2d). In
the head kidney samples, significant (p < 0.05) increases were detected in the expression
levels il-8 and ifn-γ in all treated groups compared to the group fed with commercial diet
(Figure 3c,d).
Animals 2025, 15, 1776 8 of 15

Figure 2. Relative expression of genes involved in growth and antioxidant defense system in the liver
of the fish before (a–d) and after air exposure stress (e–h). Different letters mean significant (p < 0.05)
differences between the groups. Asterisk (*) means a significant (p < 0.05) difference between values
obtained before and after air exposure in the same group. sod: superoxide dismutase; cat: catalase;
gpx: glutathione peroxidase; igf-1: insulin-like growth factor 1.
Animals 2025, 15, 1776 9 of 15

Figure 3. Relative expression of genes involved in non-specific immune response in the head kidney
of the fish before (a–d) and after air exposure stress (e–h). Different letters mean significant (p < 0.05)
differences between the groups. Asterisk (*) means a significant (p < 0.05) difference between values
obtained before and after air exposure in the same group. tnf-α: tumor necrosis factor alpha; il-1β:
interleukin-1 beta; il-8: interleukin-8; ifn-γ: interferon gamma.

Following the 5-min air exposure stress, expression levels of sod, cat, and gpx in liver
samples were significantly (p < 0.05) higher in group fed with N. gaditana (EXP-A) compared
Animals 2025, 15, 1776 10 of 15

to the other groups (Figure 2e–g), whereas the expression of igf-1 did not differ among
the groups (Figure 2h), similarly to the samples taken from before stress (Figure 2a–d).
There were no significant (p < 0.05) differences within treatments in the expression levels
of genes related to the immune response after air exposure in the head kidney samples
(Figure 3e–h).

4. Discussion
Feed additives have been added to fish diets in order to protect fish from diseases or
minimize other possible risks during the culturing period or transportation events. We
also thought that some feed additives had a protective effect against oxidative stress by
reducing the formation of free radicals. It is well known that the intake of antioxidants
and polyphenolic compounds from microalgae positively affects the antioxidant defense
systems of fish [28]. BSFL meal was considered to interact with the non-specific immune
and antioxidant defense system due to its significant chitin content [18,19]. According
to the manufacturer’s technical report, Syrena Boost at a 200 mg/kg level can enhance
the growth and survival of Nile tilapia fingerlings. Parallel with this, Yang was added
in 1 g/kg doses, which was documented as having positive effects on pathogen binding,
skin mucus production, and intestinal integrity in different aquatic species [29]. Based
on these findings, we hypothesized that this product should have an immunoboosting
effect. When comparing the three experimental treatment groups, we found that all diets
exhibited similar production parameters during the experimental period. These findings
support the assumption that N. gaditana and black soldier fly larvae meal are digestible feed
additives for Nile tilapia without compromising the growth traits of the species. It could
be concluded that all the supplementation materials contributed to good production traits
of tilapia juveniles. However, some dietary disadvantages could be observed regarding
the final body weight, specific growth rate, and feed conversion rate in the commercial
group, whose diet formulation differed from the rest of the diets in composition. As shown
in Table 1, the diets were isonitrogenous and isoenergetic, but they contained different
ratios of fish meal and soybean. The experimental diets were formulated with 51–53% fish
meal content, compared to the commercial diet’s 40%. Consequently, the soybean meal
ratio is significantly higher in the commercial diet (36%) compared to experimental diets
(approximately 18%). It appears that the lower level of fish meal in this diet, along with the
higher soybean content, adversely affected the growth of the fish and their feed utilization.
This trend is clearly visible despite the large variance observed in these parameters among
parallel cages. We concluded that the variations in the fishmeal-to-soybean meal ratio are
reflected less in amino acid composition and more in differences in nutrient digestibility
caused by the soybean. On the other side, the feeds were supplemented in 3% with premix
containing synthetic amino acids to satisfy the requirement.
Superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) en-
zymes are parts of the antioxidant defense system, which protects the cells from peroxi-
dation of lipids, proteins, and DNA by eliminating reactive oxygen species (ROS), which
appear during stressful conditions or the activation of innate immune system [30]. In
our experiment, feeding the fish with N. gaditana significantly enhanced the expression
of these three antioxidant enzymes in the liver. This result is consistent with previous
studies, in which the expression of these genes increased by feeding tilapias with N. oculata,
Golenkinia longispicula, or a mixture of different microalgae [9,31,32]. Based on our findings
of upregulation of cat, sod, and gpx genes in the liver, it seems that this additive could
activate the antioxidant functions of juvenile GIFT. Microalgae of the genus Nannochloropsis
are rich in valuable carotenoids like violaxanthin, zeaxanthin, astaxanthin, or β-carotene [4].
These molecules can neutralize ROS by accepting electrons to their conjugated double
Animals 2025, 15, 1776 11 of 15

bonds [33]. Beside this direct effect, they can activate the transcription factor Nrf2 (Nuclear
factor erythroid 2-related factor 2), which increases the expression of genes sod, cat, and
gpx [34,35]. This explains the significant increase in the expression of these genes measured
in group EXP-A. A slight increase in antioxidant gene expression in EXP-S and EXP-I
groups without significant differences from the commercial group was observed. In this
sense, the additives administered to EXP-S and EXP-I diets were not strong enough to have
an impact on the antioxidant defense system of the studied fish individuals. On the other
hand, the lack of antioxidative effect of EXP-S diet could be explained by the low inclusion
level administered into the feed (0.4%). The homogenization of solid particles in such low
concentrations into the feed may lead to an uneven distribution, resulting in inconsistent
amounts being delivered to the fish. Similarly, the dietary inclusion of BSFL at a dose of 3%
does not appear to have generated an antioxidant effect compared to higher doses reported
in the literature [36].
Insulin-like growth factor 1 (IGF-1) mediates the effect of growth hormone (GH) on
skeletal muscle. The main target organ of GH is the liver, where the transcription of the
igf-1 gene is activated via various signaling pathways [37,38]. Synthesis and release of
hepatic IGF-1 is influenced by the nutritional status of fish [26,37]. In our study, none of the
experimental diets changed the expression of igf-1 gene in the liver, which indicates that
these diets did not have significant effects on the nutritional status, and this observation is
in correlation with our growth performance data.
Pro-inflammatory cytokines play a key role in initiating and mediating the innate
(non-specific) immune response by activating their cellular components (macrophages,
natural killer cells, and granulocytes) [39]. In our experiment, the expression of four pro-
inflammatory cytokines (tnf-α, il-1β, il-8, and ifn-γ) was measured in the head kidney,
which is one of the main lymphoid organs of fishes [40]. Two of them (il-8 and inf-γ) had
significantly increased expression levels after 7 weeks of feeding with all three experimental
feeds, compared to the control group. Feed additives used in our study contain various
compounds, as was mentioned before, which may act as immunostimulants in order
to enhance the innate immune response. Similarly, in the EXP-S diet, a combination
of phytogenic and yeast-based feed additives was added, which contains saponins and
glucans, compounds with immunostimulating activities. Similar results were reported
in hepatic gene expression of Nile tilapia after 90 days of feeding with different doses
of the microalga Golenkinia longispicula [32], after 7 weeks of feeding with N. gaditana in
5 or 10% dose [9], and 30 days of feeding with Spirulina platensis in 0.25 or 0.5% dose [41].
β-carotene and phycocyanin extracted from Spirulina platensis also increased the expression
of il-1β and ifn-γ after 70 days of feeding [42]. However, a mixture of Spirulina and
Schizochytrium species and N. oculata in 1.5% and 3% doses significantly decreased the
expression of il-1β and tnf-α in Nile tilapia spleen [31]. N. oculata in 5% or 10% doses
reduced the expression of il-1β in the liver and intestine, and the expression of tnf-α in the
intestine, but not in the liver [7]. These results indicate that the effect of microalgae on
the expression of pro-inflammatory cytokines is highly dependent on the tissue and the
microalgal species. Similarly, a combination of black soldier fly larvae meal and chitinase
significantly enhanced the expression of il-6 in the head kidney of Nile tilapia juveniles after
53 days of feeding. However, no BSFL meal and chitinase combinations had a significant
effect on the expression of il-1β in head kidney compared to the control or the expression of
both cytokines in spleen, suggesting that BSFL meal can have a similar effect as microalgal
species [19]. A phytogenic feed additive, pineapple peel powder, in 5, 10, and 20 g/kg doses
significantly increased il-1β and il-8 expression in Nile tilapia liver after 8 weeks of feeding,
showing its immunomodulatory effect [27]. Fish feed supplemented with 500 mg/kg
β-glucan significantly enhanced the expression of il-1β in Nile tilapia liver after 60 days of
Animals 2025, 15, 1776 12 of 15

feeding [43]. In another experiment, the same dose of β-glucan increased the expression of
il-8 in the liver of Nile tilapias after 30 days [44]. These latter results with β-glucan indicate
that the exact effect of immunostimulants on the expression of pro-inflammatory cytokines
depends on the feeding regime as well. Accordingly, our data provide evidence that all
the tested additives may help enhance the non-specific immune system of the fish after the
feeding period.
Following the stress experiment, the EXP-A group maintained its increased antioxida-
tive capacity during the stress event compared to the rest of the treatments, similar to what
was observed at the end of the feeding period. The expressions of antioxidant enzyme genes
(sod, cat, gpx) and igf-1 were very similar before and after air exposure. Only the expression
of gpx in the EXP-S group increased significantly following the stress. In an experiment
with Nile tilapia [8], the expression of gpx in the liver was higher or lower following air
exposure, compared to the pre-stress levels, depending on the dose of N. oculata mixed into
the feed (5 or 10%, respectively). These doses were higher than the 3.5% of N. gaditana,
which is the inclusion level we had in our experiment, demonstrating that the antioxidant
effect of microalgae is dose-dependent. Feeding Nile tilapias with 500 mg/kg β-glucan
supplementation for 30 days significantly increased the expression of gpx in the liver of
fish exposed to a subacute dose of deltamethrin, compared to the non-exposed fish [43].
This was similar to what we found in the EXP-S group after the air exposure. However, in
this case, the expression of cat was also significantly higher in the stressed group, which
was different from our result. This indicates that the type (acute or subacute) of stress also
affects the expression of antioxidant genes in Nile tilapia liver.
The expression of pro-inflammatory cytokine genes (tnf-α, il-1β, il-8, ifn-γ) detected in
the head kidney after the air exposure did not differ significantly among the experimental
groups in our study, which indicates that the acute stress decreased the immunomodulatory
effect of the experimental feeds detected at the end of feeding. However, a positive trend
in the non-specific immune response of tilapias fed with feed additives compared to the
control group could be observed following air exposure. Compared to the pre-stress state,
only the expression of ifn-γ decreased significantly in the EXP-A group (Figure 3d,h).
Similar results were found in Nile tilapia liver and intestine, where the expression of tnf-α
and il-1β after air exposure was not different between the experimental groups, which
were fed with feeds supplemented with 5 and 10% of N. oculata [7]. In the same study,
the expression of tnf-α significantly decreased after the stress, compared to the pre-stress
level in the 10% group. In contrast to this and to our results, expression of il-1β remained
elevated in the liver of Nile tilapias fed with 0.25 and 0.5% Spirulina platensis following acute
cold or hypoxia stress [41]. However, this can be explained by the stronger effect of direct
air exposure as a stressor. Following 30 days of exposure to a subacute dose of deltamethrin,
the expression of pro-inflammatory cytokines either increased (ifn-γ), decreased (il-8), or
remained at the same level (il-1β) in Nile tilapia liver, compared to the control. In the
same experiment, feeding the deltamethrin-treated fish with 500 mg/kg β-glucan during
the experiment significantly increased the expression of il-8 and il-1β, compared to the
fish treated with deltamethrin only [43]. These results suggest that the expression of pro-
inflammatory cytokines depends on the type of stress, similar to antioxidant genes. Finally,
we concluded that all three studied feed additives in their respective doses improved the
innate immune response of Nile tilapias after 7 weeks of feeding. Moreover, the elevated
antioxidant capacity of the N. gaditana-fed group was maintained even after the stress.

5. Conclusions
Following the 7-week feeding trial, all supplemented diets performed similarly, with
good production and nutrient utilization parameters, and feed cost per unit of weight
Animals 2025, 15, 1776 13 of 15

gain. It can be assumed that N. gaditana supplementation enhanced the antioxidant defense
system of the fish by increasing the expression of genes encoding important antioxidant
enzymes. Furthermore, all tested additives enhanced the non-specific immune response of
the fish after the feeding period. Following air exposure, the increased antioxidant effect
was maintained in the fish fed with N. gaditana supplementation, while the immunomod-
ulatory effect of the additives observed following feeding was somehow decreased via
air exposure. Based on our results, we recommend the application of any of the studied
additives in the tested doses to enhance the innate immune response of Nile tilapia. In
addition to its immunomodulatory properties, N. gaditana in 3.5% can be applied to increase
the antioxidant defence capacity as well.

Author Contributions: L.A. conceptualization, methodology, writing—original draft preparation;

M.O. conceptualization, writing—review and editing; J.S. formal analysis; J.B. writing—original draft
preparation; A.A.S. investigation, formal analysis; G.K. investigation; M.L. resources, investigation,
writing—review and editing; B.G. conceptualization, funding acquisition; Z.B.-M. visualization; Z.J.S.
conceptualization, writing—original draft preparation, visualization, funding acquisition; E.B. formal
analysis, resources, writing—original draft preparation. All authors have read and agreed to the
published version of the manuscript.

Funding: The work was supported by the H2020 EU framework, the iFishIENCi project (GA 818036).

Institutional Review Board Statement: All procedures involving fish were conducted in accordance
with the Law on Animal Husbandry and Veterinary (Revised) No. 08/NA, dated 11 November 2016,
of the Lao People’s Democratic Republic. All efforts were made to minimize the suffering of the fish.

Informed Consent Statement: Not applicable.

Data Availability Statement: The original contributions presented in this study are included in the
article. Further inquiries can be directed to the corresponding author.

Acknowledgments: The authors are thankful to the technical staff of MATE and ADC for their
support in laboratory sample analyses and fish maintenance. The work of Zsuzsanna J. Sandor was
supported by the Research Excellence Programme of the Hungarian University of Agriculture and
Life Sciences.

Conflicts of Interest: Márton Orbán and Balázs Gregosits, as employees of Vitafort Zrt. company;
János Szakáli, as an employee of Vitafort Agro Asia Zrt. company; Michelle Lévai, as an employee
of ADC Aquatic Development Company Ltd.; and co-authors of the submitted manuscript, hereby
declare that there are NO personal circumstances or interests that may be perceived as inappropriately
influencing the representation or interpretation of the reported research results. The commercial feed
supplement used in the study was a mixture of commercially available feed additives produced by
various companies. The authors have no affiliation with the producers.

References
1. FAO FishstatJ. Global Aquaculture Production 1950–2022; FishStatJ: 2024. Available online: www.fao.org/fishery/en/statistics/
software/fishstatj (accessed on 30 April 2025).
2. Kesarcodi-Watson, A.; Kaspar, H.; Lategan, M.J.; Gibson, L. Probiotics in aquaculture: The need, principles and mechanisms of
action and screening processes. Aquaculture 2008, 274, 1–14. [CrossRef]
3. Gupta, A.; Gupta, S.K.; Priyam, M.; Siddik, M.A.B.; Kumar, N.; Mishra, P.K.; Gupta, K.K.; Sarkar, B.; Sharma, T.R.; Pattanayak, A.
Immunomodulation by dietary supplements: A preventive health strategy for sustainable aquaculture of tropical freshwater fish,
Labeo rohita (Hamilton, 1822). Rev. Aquac. 2021, 13, 2364–2394. [CrossRef]
4. Zanella, L.; Vianello, F. Microalgae of the genus Nannochloropsis: Chemical composition and functional implications for human
nutrition. J. Funct. Foods 2020, 68, 103919. [CrossRef]
5. Chua, E.T.; Schenk, P.M. A biorefinery for Nannochloropsis: Induction, harvesting, and extraction of EPA-rich oil and high-value
protein. Bioresour. Technol. 2017, 244, 1416–1424. [CrossRef] [PubMed]
6. du Preez, R.; Majzoub, M.E.; Thomas, T.; Panchal, S.K.; Brown, L. Nannochloropsis oceanica as a microalgal food intervention in
diet-induced metabolic syndrome in rats. Nutrients 2021, 13, 3991. [CrossRef]
Animals 2025, 15, 1776 14 of 15

7. Zahran, E.; Elbahnaswy, S.; Ibrahim, I.; Khaled, A.A. Nannochloropsis oculata enhances immune response, transcription of stress,
and cytokine genes in Nile tilapia subjected to air exposure stress. Aquac. Rep. 2021, 21, 100911. [CrossRef]
8. Abdelghany, M.F.; El-Sawy, H.B.; Abd El-hameed, S.A.A.; Khames, M.K.; Abdel-Latif, H.M.R.; Naiel, M.A.E. Effects of dietary
Nannochloropsis oculata on growth performance, serum biochemical parameters, immune responses, and resistance against
Aeromonas veronii challenge in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2020, 107, 277–288. [CrossRef]
9. Zahran, E.; Elbahnaswy, S.; Ahmed, F.; Ibrahim, I.; Khaled, A.A.; Eldessouki, E.A. Nutritional and immunological evaluation of
Nannochloropsis oculata as a potential Nile tilapia-aquafeed supplement. BMC Vet. Res. 2023, 19, 65. [CrossRef]
10. Ayala, M.D.; Galián, C.; Fernández, V.; Chaves-Pozo, E.; de la Serrana, D.G.; Sáez, M.I.; Díaz, A.G.; Alarcón, F.J.; Martínez, T.F.;
Arizcun, M. Influence of low dietary inclusion of the microalga Nannochloropsis gaditana (Lubián 1982) on performance, fish
morphology, and muscle growth in juvenile gilthead seabream (Sparus aurata). Animals 2020, 10, 2270. [CrossRef]
11. Sáez, M.I.; Galafat, A.; Vizcaíno, A.J.; Chaves-Pozo, E.; Ayala, M.D.; Arizcun, M.; Alarcón, F.J.; Suárez, M.D.; Martínez, T.F.
Evaluation of Nannochloropsis gaditana raw and hydrolysed biomass at low inclusion level as dietary functional additive for
gilthead seabream (Sparus aurata) juveniles. Aquaculture 2022, 556, 738288. [CrossRef]
12. Zulkifli, N.F.N.M.; Seok-Kian, A.Y.; Seng, L.L.; Mustafa, S.; Kim, Y.S.; Shapawi, R. Nutritional value of black soldier fly (Hermetia
illucens) larvae processed by different methods. PLoS ONE 2022, 17, e0263924. [CrossRef] [PubMed]
13. Müller, A.; Wolf, D.; Gutzeit, H.O. The black soldier fly, Hermetia illucens—A promising source for sustainable production of
proteins, lipids and bioactive substances. Z. Fur Naturforschung—Sect. C J. Biosci. 2017, 72, 351–363. [CrossRef] [PubMed]
14. Kumar, V.; Fawole, F.J.; Romano, N.; Hossain, M.S.; Labh, S.N.; Overturf, K.; Small, B.C. Insect (black soldier fly, Hermetia illucens)
meal supplementation prevents the soybean meal-induced intestinal enteritis in rainbow trout and health benefits of using insect
oil. Fish Shellfish Immunol. 2021, 109, 116–124. [CrossRef] [PubMed]
15. Abdel-Latif, H.M.R.; Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Ghetas, H.A.; Khallaf, M.A. Black
soldier fly (Hermetia illucens) larvae meal in diets of European seabass: Effects on antioxidative capacity, non-specific immunity,
transcriptomic responses, and resistance to the challenge with Vibrio alginolyticus. Fish Shellfish Immunol. 2021, 111, 111–118.
[CrossRef]
16. Xiao, X.; Jin, P.; Zheng, L.; Cai, M.; Yu, Z.; Yu, J.; Zhang, J. Effects of black soldier fly (Hermetia illucens) larvae meal protein as a
fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquac. Res. 2018, 49, 1569–1577.
[CrossRef]
17. Foysal, M.J.; Fotedar, R.; Tay, C.Y.; Gupta, S.K. Dietary supplementation of black soldier fly (Hermetica illucens) meal modulates
gut microbiota, innate immune response and health status of marron (Cherax cainii, Austin 2002) fed poultry-by-product and
fishmeal based diets. PeerJ 2019, 7, e6891. [CrossRef]
18. Agbohessou, P.S.; Mandiki, S.N.M.; Gougbédji, A.; Megido, R.C.; Hossain, M.S.; De Jaeger, P.; Larondelle, Y.; Francis, F.; Lalèyè,
P.A.; Kestemont, P. Total replacement of fish meal by enriched-fatty acid Hermetia illucens meal did not substantially affect growth
parameters or innate immune status and improved whole body biochemical quality of Nile tilapia juveniles. Aquac. Nutr. 2021,
27, 880–896. [CrossRef]
19. Agbohessou, P.S.; Mandiki, S.N.M.; Mbondo Biyong, S.R.; Cornet, V.; Nguyen, T.M.; Lambert, J.; Jauniaux, T.; Lalèyè, P.A.;
Kestemont, P. Intestinal histopathology and immune responses following Escherichia coli lipopolysaccharide challenge in Nile
tilapia fed enriched black soldier fly larval (BSF) meal supplemented with chitinase. Fish Shellfish Immunol. 2022, 128, 620–633.
[CrossRef]
20. Tippayadara, N.; Dawood, M.A.O.; Krutmuang, P.; Hoseinifar, S.H.; Doan, H.; Van Paolucci, M. Replacement of fish meal by black
soldier fly (Hermetia illucens) larvae meal: Effects on growth, haematology, and skin mucus immunity of Nile tilapia, Oreochromis
niloticus. Animals 2021, 11, 193. [CrossRef]
21. MSZ EN ISO 16634-1:2009; Hungarian Standard. Determination of Total Nitrogen Content by Combustion According to the
Dumas Principle and Calculation of Crude Protein Content—Part 1: Oilseeds and Feedingstuffs. Hungarian Standards Institute:
Budapest, Hungary, 2009.
22. Guan, L.; Zhao, M.; Liu, T.; Fan, X.; Chen, D. Cooling combined with hyperoxic CO2 anesthesia is effective in improving the air
exposure duration of tilapia. Sci. Rep. 2017, 7, 14016. [CrossRef]
23. Fan, X.; Zhao, M.; Guan, W.; Liu, T.; Chen, D. Carbon dioxide anesthesia: A potential application to improve the air exposure
duration of tilapia. Iran. J. Fish. Sci. 2022, 21, 82–92.
24. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method.
Methods 2001, 25, 402–408. [CrossRef] [PubMed]
25. Yilmaz, E. Effects of dietary anthocyanin on innate immune parameters, gene expression responses and ammonia resistance of
Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2019, 93, 694–701. [CrossRef]
26. Amin, A.; El Asely, A.; Abd El-Naby, A.S.; Samir, F.; El-Ashram, A.; Sudhakaran, R.; Dawood, M.A.O. Growth performance, intesti-
nal histomorphology and growth-related gene expression in response to dietary Ziziphus mauritiana in Nile tilapia (Oreochromis
niloticus). Aquaculture 2019, 512, 734301. [CrossRef]
Animals 2025, 15, 1776 15 of 15

27. Van Doan, H.; Hoseinifar, S.H.; Harikrishnan, R.; Khamlor, T.; Punyatong, M.; Tapingkae, W.; Yousefi, M.; Palma, J.; El-Haroun,
E. Impacts of pineapple peel powder on growth performance, innate immunity, disease resistance, and relative immune gene
expression of Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2021, 114, 311–319. [CrossRef]
28. Abdel-Daim, M.M.; Dawood, M.A.O.; Elbadawy, M.; Aleya, L.; Alkahtani, S. Spirulina platensis reduced oxidative damage
induced by chlorpyrifos toxicity in nile tilapia (Oreochromis niloticus). Animals 2020, 10, 473. [CrossRef] [PubMed]
29. Rawling, M.; Dimitroglou, A.; Leclercq, E.; Castex, M.; Barkas, D.; Merrifield, D. Effects of a yeast-based functional additive on
the skin and intestinal mucosal surfaces of juvenile gilthead seabream (Sparus aurata). In Proceedings of the Aquaculture Europe
2017, Dubrovnik, Croatia, 17–20 October 2017; pp. 958–959.
30. Chowdhury SSaikia, S.K. Oxidative Stress in Fish: A Review. J. Sci. Res. 2020, 12, 145–160. [CrossRef]
31. Ibrahim, D.; Abd El-Hamid, M.I.; Al-Zaban, M.I.; Elhady, M.; El-Azzouny, M.M.; Elfeky, T.M.; Al Sadik, G.M.; Samy, O.M.;
Hamed, T.A.; Albalwe, F.M.; et al. Impacts of fortifying Nile tilapia (Oreochromis niloticus) diet with different strains of microalgae
on its performance, fillet quality and disease resistance to Aeromonas hydrophila considering the interplay between antioxidant
and inflammatory response. Antioxidants 2022, 11, 2181. [CrossRef]
32. Moawad, D.A.; El-Garhy, H.A.S.; Refaat, M.H.; Hassaan, M.S. Protecting deleterious effects of high stocking density of Nile
tilapia, Oreochromis niloticus using dietary microalgae Golenkinia longispicula: Growth, immune-oxidative markers and associated
gene expression. Aquaculture 2024, 581, 740430. [CrossRef]
33. Zuluaga, M.; Gueguen, V.; Pavon-Djavid, G.; Letourneur, D. Carotenoids from microalgae to block oxidative stress. BioImpacts
2017, 7, 1–3. [CrossRef]
34. Kaulmann, A.; Bohn, T. Carotenoids, inflammation and oxidative stress—implications of cellular signaling pathways and relation
to chronic disease prevention. Nutr. Res. 2014, 34, 907–929. [CrossRef] [PubMed]
35. Bohn, T. Carotenoids and markers of oxidative stress in human observational studies and intervention trials: Implications of
chronic diseases. Antioxidants 2019, 8, 179. [CrossRef] [PubMed]
36. Li, S.; Ji, H.; Zhang, B.; Zhou, J.; Yu, H. Defatted black soldier fly (Hermetia illucens) larvae meal in diets for juvenile Jian
carp (Cyprinus carpio var. Jian): Growth performance, antioxidant enzyme activities, digestive enzyme activities, intestine and
hepatopancreas histological structure. Aquaculture 2017, 477, 62–70. [CrossRef]
37. Pérez-Sánchez, J.; Le Bail, P.Y. Growth hormone axis as marker of nutritional status and growth performance in fish. Aquaculture
1999, 177, 117–128. [CrossRef]
38. Fuentes, E.N.; Valdés, J.A.; Molina, A.; Björnsson, B.T. Regulation of skeletal muscle growth in fish by the growth hormone—
Insulin-like growth factor system. Gen. Comp. Endocrinol. 2013, 192, 136–148. [CrossRef]
39. Zou, J.; Secombes, C.J. The function of fish cytokines. Biology 2016, 5, 23. [CrossRef]
40. Uribe, C.; Folch, H.; Enriquez, R.; Moran, G. Innate and adaptive immunity in teleost fish: A review. Vet. Med. 2011, 56, 486–503.
[CrossRef]
41. Elabd, H.; Wang, H.P.; Shaheen, A.; Matter, A. Nano spirulina dietary supplementation augments growth, antioxidative and
immunological reactions, digestion, and protection of Nile tilapia, Oreochromis niloticus, against Aeromonas veronii and some
physical stressors. Fish Physiol. Biochem. 2020, 46, 2143–2155. [CrossRef] [PubMed]
42. Hassaan, M.S.; Mohammady, E.Y.; Soaudy, M.R.; Sabae, S.A.; Mahmoud, A.M.A.; El-Haroun, E.R. Comparative study on the
effect of dietary β-carotene and phycocyanin extracted from Spirulina platensis on immune-oxidative stress biomarkers, genes
expression and intestinal enzymes, serum biochemical in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2021, 108,
63–72. [CrossRef]
43. Dawood, M.A.O.; Abdo, S.E.; Gewaily, M.S.; Moustafa, E.M.; SaadAllah, M.S.; AbdEl-kader, M.F.; Hamouda, A.H.; Omar, A.A.;
Alwakeel, R.A. The influence of dietary β-glucan on immune, transcriptomic, inflammatory and histopathology disorders caused
by deltamethrin toxicity in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2020, 98, 301–311. [CrossRef]
44. Dawood, M.A.O.; Metwally, A.E.S.; El-Sharawy, M.E.; Atta, A.M.; Elbialy, Z.I.; Abdel-Latif, H.M.R.; Paray, B.A. The role of
β-glucan in the growth, intestinal morphometry, and immune-related gene and heat shock protein expressions of Nile tilapia
(Oreochromis niloticus) under different stocking densities. Aquaculture 2020, 523, 735205. [CrossRef]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.