Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

https://doi.org/10.30910/turkjans.1656992

Original Article
Molecular characterization of some peach and nectarine hybrids by ISSR and SSR markers

Aycan Bayav1, Dicle Dönmez2, Songül Çömlekçioğlu3, Ayzin Küden3, Yıldız Aka Kaçar1,3:
1Department of Biotechnology, Natural and Applied Sciences, Çukurova University, Adana, Türkiye
2Biotechnology Research and Application Center, Çukurova University, Adana, Türkiye
3
Department of Horticulture, Faculty of Agriculture, Çukurova University, Adana, Türkiye

1 https://orcid.org/0009-0003-4320-7175, 2 https://orcid.org/0000-0002-7446-9405, 3 https://orcid.org/0000-0003-1275-4574,

4 https://orcid.org/0000-0002-0811-6695, 5 https://orcid.org/0000-0001-5314-7952

:
[email protected]

ABSTRACT
The Prunus genus includes valuable fruit trees such as cherries, almonds, apricots, plums, peaches, and
nectarines. Peaches and nectarines are among the most widely cultivated fruits globally and can adapt to
temperate and subtropical climate conditions. In this study, the genetic relationships of 96 peach and nectarine
hybrids were analyzed using Simple Sequence Repeat (SSR) and Simple Intersequence Repeat (ISSR) markers.
These genotypes consist of hybrid VxÜ (Venüs x Üstün) and RxÜ (Stark Red Gold x Üstün) obtained through the
hybridization of peach and nectarine varieties. 5 SSR and 14 ISSR primers were used for both VxÜ and RxÜ
genotypes. In the SSR analysis of hybrid VxÜ and RxÜ genotypes, 12 bands were obtained, all polymorphic,
resulting in a polymorphism rate of 100%. The band size ranged from 150 to 240 bp. The PIC values ranged
from 0.32 to 0.91, with an average of 0.62. In the ISSR analysis of hybrid RxÜ and VxÜ genotypes, 163 bands
were obtained, of which 150 were polymorphic and polymorphism rate of 91%. The band size range varied
between 300 and 2000 bp. Genetic similarity values among genotypes were calculated, and a UPGMA cluster
analysis was performed to create a dendrogram. The data and dendrograms obtained from genetic analysis
were compared. The dendrograms generated from the SSR and ISSR analyses were divided into two main
clusters. In the dendrogram based on SSR analysis, the VÜ-103 hybrid formed a distinct group, separate from
all other genotypes. Conversely, in the dendrogram derived from ISSR analysis, the VÜ hybrids clustered within
the first main branch, while the RU hybrids were grouped within the second main branch. The results of the
study showed that both SSR and ISSR markers are potential tools for determining genetic diversities and
genetic relationships of Prunus hybrids and can be used in breeding programs.

Key words: Peach, Nectarine, Molecular Characterization, SSR, ISSR

Bazı şeftali ve nektarin melezlerinin ISSR ve SSR belirteçleri ile moleküler karakterizasyonu

ÖZ
Prunus cinsi kiraz, badem, kayısı, erik, şeftali ve nektarin gibi değerli meyve ağaçlarını içerir. Şeftali ve
nektarinler dünyada en yaygın yetiştirilen meyveler arasındadır ve ılıman ve subtropikal iklim koşullarına uyum
sağlayabilir. Bu çalışmada, 96 şeftali ve nektarin melezinin genetik ilişkileri Basit Dizi Tekrarı (SSR) ve Basit
Diziler Arası Tekrar (ISSR) markırları kullanılarak analiz edilmiştir. Bu genotipler şeftali ve nektarin çeşitlerinin
melezlenmesiyle elde edilen hibrit VxÜ (Venüs x Üstün) ve RxÜ'den (Stark Red Gold x Üstün) oluşmaktadır. Hem
VxÜ hem de RxÜ genotipleri için 5 SSR ve 14 ISSR primeri kullanılmıştır. Hibrit VxÜ ve RxÜ genotiplerinin SSR
analizinde, hepsi polimorfik olan 12 bant elde edilmiş ve %100 polimorfizm oranı elde edilmiştir. Bant
büyüklüğü 150 ila 240 bp arasında değişmiştir. PIC değerleri 0,32 ila 0,91 arasında değişmiş, ortalama 0,62
olarak belirlenmiştir. Hibrit RxÜ ve VxÜ genotiplerinin ISSR analizinde 163 bant elde edilmiş, bunların 150'si
polimorfik olarak belirlenmiş ve polimorfizm oranı %91 olarak saptanmıştır. Bant büyüklüğü 300 ile 2000 bp
arasında değişmiştir. Genotipler arasındaki genetik benzerlik değerleri hesaplanmış ve bir dendrogram

552
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

oluşturmak için bir UPGMA kümeleme analizi yapılmıştır. Genetik analizden elde edilen veriler ve
dendrogramlar karşılaştırılmıştır. SSR ve ISSR analizleri sonucunda elde edilen dendrogramlar 2 ana kola
ayrılmıştır. SSR analizleri ile elde edilen dendrogramda VÜ-103 genotipi diğer tüm genotiplerden ayrı grupta yer
almıştır. ISSR analizleri ile elde edilen dendrogramda 1. ana kolda VÜ genotipleri, 2. ana kolda ise RÜ genotipleri
kümelenmiştir. Çalışmanın sonuçları, hem SSR hem de ISSR belirteçlerinin Prunus melezlerinin genetik
çeşitliliğini ve genetik ilişkilerini belirlemek için potansiyel araçlar olduğunu ve ıslah programlarında
kullanılabileceğini göstermiştir.

Anahtar kelimeler: Şeftali, Nektarin, Moleküler Karakterizasyon, SSR, ISSR.

INTRODUCTION
Peach (Prunus persica) is a highly nutritious and valuable fruit, recognized for its significant food and
nutritional benefits. Both peach and nectarine are essential today for their culinary applications and
ornamental purposes. The high economic value of peach is of considerable commercial significance.
Considering these factors, research on peach and nectarine in fruit breeding has become increasingly vital
(Eroğlu and Mısırlı, 2012). Peach-growing regions are typically located in temperate and subtropical climates,
between latitudes of 30° and 45°. Countries such as China, Spain, Turkey, Greece, Iran, the USA, Egypt, Chile,
and India are prominent producers. The origin of peach is widely accepted to be Iran (Persia). Historical records
from China suggest that peaches spread from China to Iran and subsequently to Europe (LaRue, 1989; Dosba,
2003; Okie et al., 2008). Peaches are classified into three distinct forms: Hairy peaches (P. persica vulgaris
Mill.), Hairless peaches (nectarines) (P. persica var. nectarina Maxim.), and Tomato peaches (P. persica var.
platycarpa). Nectarines are a botanical variety of peaches; however, they are distinguished by their hairless
fruit skin, which is caused by the expression of a recessive gene within nectarine genetics (Yüce, 2018). Like
peaches, nectarines are grown in temperate climates. The diploid chromosomal structure of both peaches and
nectarines offers advantages for breeding studies and new variety development, though it also presents certain
susceptibilities.
The phenolic compounds found in peaches contribute significantly to their sensory appeal and flavor,
but they also play a role in the potential browning of the fruit during its development (Kaynaş et al., 2022). In
plant breeding, it is essential to investigate parameters such as genome mapping, phylogenetic analysis, gene
tagging, genetic diversity, and interspecific relationships, as they are critical for understanding species diversity.
Through breeding efforts, nectarines have been developed with a hairless trait, similar nutritional value to
peaches, and considerable commercial value.
Considering the broader context of plant breeding, including the economic development of our country,
the conservation of our cultural heritage, and the enhancement of genome libraries used in fruit breeding, the
significance of plant breeding studies becomes apparent. Developing new plant varieties through breeding is
crucial for food diversity, human health, and the well-being of organisms that rely on plants for nutrition,
ultimately contributing to maintaining ecological balance (Yu et al., 2021). Today, molecular markers have
significantly reduced the time and effort required in plant breeding studies. The application of molecular
markers in fruit cultivation plays a pivotal role in clarifying genetic references, enabling more accurate,
efficient, and informed breeding processes while safeguarding these genetic resources (Filiz and Koç, 2011).
Molecular markers can be broadly categorized into two groups: PCR-based marker systems and non-
PCR-based marker systems. RFLP (Restriction Fragment Length Polymorphism) is an example of a non-PCR-
based marker technique. PCR-based molecular markers include AFLP (Amplified Fragment Length
Polymorphism), RAPD (Random Amplified Polymorphic DNA), VNTR (Variable Number of Tandem Repeats),
CAPS (Cleaved Amplified Polymorphic Sequences), organelle microsatellites (e.g., chloroplast DNA), SRAP
(Sequence-Related Amplified Polymorphism), TRAP (Tartrate-Resistant Acid Phosphatase), and EST (Expressed
Sequence Tag) marker technologies. Additionally, SSR (Simple Sequence Repeat) and ISSR (Inter-Simple
Sequence Repeat) marker techniques are frequently employed in plant breeding research (Domblides and
Domblides, 2023; Yang et al., 2023; Schulman, 2007; Sang et al., 2021; Güleç et al., 2010). Molecular marker
techniques are crucial tools for identifying genetic differences at the DNA sequence level.
Microsatellites, also known as simple sequence repeats (SSRs), consist of repeated motifs of 1 to 6
nucleotides. The gene sequences flanking these microsatellite regions are inherited in a stable, non-variable
manner between individuals of different species, allowing for the determination of species diversity (Aka Kaçar,
2004). This feature makes SSR markers particularly advantageous in various scientific studies, such as genetic
mapping, gene tagging, and interspecies characterization. SSR markers offer several benefits, including
requiring minimal DNA amounts, being codominant and stable, being widely distributed throughout the

553
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

genome, having high polymorphism, and being suitable for automation and high-throughput analysis (Powell et
al., 1996). ISSR (Inter-Simple Sequence Repeat) markers amplify the DNA region between two microsatellites
using primers that are specific and structurally unique (e.g., double, triple, quadruple, quintuple repeats). The
ISSR marker is a dominant marker, and a significant advantage is its ability to specifically amplify the DNA
region between two microsatellites without the need for sequence information. ISSR markers are widely used
in research on gene mapping, genetic characterization, and the assessment of genetic similarity (Yorgancılar et
al., 2015). This study aimed to determine the molecular characterization and genetic relationships of peach and
nectarine varieties and their hybrids developed during the breeding process using SSR and ISSR markers.

MATERIALS AND METHODS

Plant Materials
In this study, the Üstün peach variety, Venüs nectarine variety, Stark Red Gold nectarine variety, and
their hybrids, all belonging to the P. persica species within the Rosaceae family, were utilized. The Üstün peach
variety is a J.H. Hale-type peach obtained through a bud mutation. It has a late ripening period, typically
observed at altitudes between 1400 and 1500 meters. The fruit exhibits a distinctly hairy skin with red cheeks
on a yellow background. The fruit stem is shorter compared to other peach varieties. The flesh is firm and
yellow, and the flavor profile is notably pleasant. The flesh of the Venüs nectarine variety is yellow, and the
fruit ripens late. It is a pomologically significant variety with promising traits for breeding, including its taste,
fruit size, and color. Its ripening period is approximately 10 days later than that of the Stark Red Gold nectarine
variety. The Stark Red Gold nectarine variety, characterized by yellow flesh, is distinguished by its late ripening,
larger size, and flavor, which align with the traits of the Venüs nectarine variety. It ripens about 10 days earlier
than the Venüs nectarine variety (Çömlekçioğlu, 2014). The RÜ hybrid genotypes exhibit a later flowering time.
Genotypes with higher fruit weight have been observed. Furthermore, the body diameter of RÜ hybrids was
found to be thicker compared to VÜ hybrids. Specifically, the body of the RÜ8 genotype was measured at
108.12 mm. Upon examination of the genotypes, it was observed that the hairier genotypes were
predominantly present in the RÜ hybrid group. A significant number of nectarine genotypes were produced in
the VÜ hybrids. VÜ hybrids have a shorter harvest period compared to RÜ hybrids. Additionally, it was noted
that the flesh of nectarines derived from VÜ hybrids is typically white or yellow (Çömlekçioğlu, 2014). The
variety and hybrid genotypes utilized in this study are presented in Table 1. A total of 96 genotypes, consisting
of 48 RÜ and 48 VÜ hybrids, were employed for the analysis. These hybrids were developed through research
conducted as part of peach and nectarine breeding programs at the Department of Horticulture, Faculty of
Agriculture, Çukurova University.

Table 1. Varieties and hybrids used in this study

No Genotype No Genotype No Genotype No Genotype
1 Stark Red Gold 25 RÜ- 43 1 Venüs 25 VÜ-86
2 Üstün 26 RÜ- 46 2 Üstün 26 VÜ-88
3 RÜ- 2 27 RÜ- 47 3 VÜ-1 27 VÜ-89
4 RÜ- 4 28 RÜ- 53 4 VÜ-6 28 VÜ-91
5 RÜ- 5 29 RÜ- 61 5 VÜ-13 29 VÜ-92
6 RÜ- 6 30 RÜ- 65 6 VÜ-15 30 VÜ-96
7 RÜ- 8 31 RÜ- 69 7 VÜ-24 31 VÜ-100
8 RÜ- 10 32 RÜ- 71 8 VÜ-34 32 VÜ-101
9 RÜ- 11 33 RÜ- 73 9 VÜ-41 33 VÜ-102
10 RÜ- 12 34 RÜ- 76 10 VÜ-65 34 VÜ-103
11 RÜ- 13 35 RÜ- 78 11 VÜ-70 35 VÜ-104
12 RÜ- 16 36 RÜ- 80 12 VÜ-71 36 VÜ-107
13 RÜ- 17 37 RÜ- 81 13 VÜ-73 37 VÜ-109
14 RÜ- 18 38 RÜ- 84 14 VÜ-74 38 VÜ-110
15 RÜ- 19 39 RÜ- 85 15 VÜ-75 39 VÜ-111
16 RÜ- 22 40 RÜ- 87 16 VÜ-76 40 VÜ-112
17 RÜ- 23 41 RÜ- 88 17 VÜ-77 41 VÜ-113
18 RÜ- 24 42 RÜ- 90 18 VÜ-78 42 VÜ-114
19 RÜ- 31 43 RÜ- 92 19 VÜ-79 43 VÜ-115
20 RÜ- 33 44 RÜ- 93 20 VÜ-80 44 VÜ-116
21 RÜ- 34 45 RÜ- 95 21 VÜ-81 45 VÜ-117
22 RÜ- 36 46 RÜ-101 22 VÜ-82 46 VÜ-118
23 RÜ- 40 47 RÜ-104 23 VÜ-83 47 VÜ-119
24 RÜ- 41 48 RÜ-109 24 VÜ-85 48 VÜ-120

554
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Methods
DNA Isolation and PCR Amplification Protocols
In this study, young leaves from cultivars and hybrids were utilized for DNA isolation. The leaves were
washed thoroughly with distilled water, wrapped in aluminum foil, rapidly frozen in liquid nitrogen (-196°C),
and subsequently stored at -80°C. DNA extraction was performed using the CTAB method as described by
(Edwards et al., 1991). DNA concentration was measured using a NanoDrop ND 100 spectrophotometer
(NanoDrop Technologies) and gel electrophoresis (Aka Kaçar et al., 2014).

SSR Analysis
PCR reactions were performed using five synthetically designed SSR primers specific to Prunus species,
have high levels of polymorphism, as described by Aka Kaçar et al. (2005) (Table 2). Each reaction was prepared
in a total volume of 20 µL, with the following components and their concentrations: ddH₂O: 5.00 µL, PCR
Master Mix (2X): 8.00 µL, MgCl₂: 0.50 µL, M13 primer (Forward & Reverse): 0.50 µL, F + R primer: 1.00 µL,
Template DNA (5 ng): 5.00 µL, Taq DNA polymerase: 0.05 µL. The amplifications were carried out using a Veriti
thermal cycler (Applied Biosystems) under the following conditions: Initial denaturation: 95 ˚C for 5 min, 35
cycles of denaturation: 95 ˚C for 1 min, annealing: 55 ˚C for 30 sec, extension: 72 ˚C for 1 min, and final
extension: 72 ˚C for 6 min.

Polyacrylamide Gel Preparation for Li-Cor Analysis

6.5% polyacrylamide gels were prepared for Li-Cor gel electrophoresis. The gel composition was as
follows: Urea: 8.4 g, 50% long ranger acrylamide: 2.4 mL, 10X TBE buffer: 2.0 mL, TEMED: 15 µL, ammonium
persulfate (APS, 10%): 150 µL. The operating parameters for preheating were set to 1000 V, 35 mA, and 25 W
at 45°C for 25 minutes. After adding formamide loading buffer, the samples were denatured at 95°C for 4
minutes, and 1 µL was loaded onto the gel. Electrophoresis was conducted under the following conditions:
1500 V, 35 mA, and 50 W at 48°C for 1.5 hours.

Table 2. SSR primers used in the study

No Primer code Sequence
1 BPPCT009 F:ATTCGGGTCGAACTCCCT R:ACGAGCACTAGAATAACCCTCTC
2 MA014 F:CCATGAACCCGGAGAGAGAA R:CAACACGTGTCATCCGTTCG
3 BBCT012 F:ACTTCCATTGTCAGGCATCA R:GGAGCAACGATGGAGTGC
4 BBCT008 F:ATGGTGTGTATGGACATGATGA R:CCTCAACCTAAGACACCTTCACT
5 BBCT004 F:CTGAGTGATCCATTTGCAGG R:AGGGCATCTAGACCTCATTGTT

ISSR Analysis
PCR reactions were conducted using 14 synthetically designed ISSR primers. These primers were
selected based on their demonstration of 100% polymorphism in a study by (Genişel 2013). Details of the
primers used in this study are presented in Table 3.

Table 3. ISSR primers used in the study

No Primer Code Sequance ( 5’-3’ )
1 UBC 807 AGA GAG AGA GAG AGA GT
2 UBC 808 AGA GAG AGA GAG AGA GC
3 UBC 810 GAG AGA GAG AGA GAG AT
4 UBC 811 GAG AGA GAG AGA GAG AC
5 UBC 812 GAG AGA GAG AGA GAG AC
6 UBC 815 CTC TCT CTC TCT CTC TG
7 UBC 816 CAC ACA CAC ACA CAC AT
8 UBC 818 CAC ACA CAC ACA CAC AG
9 UBC 820 GTG TGT GTG TGT GTG TC
10 UBC 827 ACA CAC ACA CAC ACA CG
11 UBC 834 AGA GAG AGA GAG AGA GT
12 UBC 835 AGA GAG AGA GAG AGA GC
13 UBC 845 CTC TCT CTC TCT CTC TG
14 UBC 850 GTG TGT GTG TGT GTG TC

555
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

ISSR-PCR analyses were performed in a volume of 25 ul mixing with 10 ng of RÜ and VÜ DNA template,
2X PCR Mastermix (Fermentas K0171, Waltham, MA, USA), 25 mM MgCl2, 10 μM primer, and 1 U of Taq DNA
polymerase (Fermentas EP0402). PCR amplifications were carried out in a Veriti thermal cycler (Applied
Biosystems) using the following program: initial denaturation for 3 min at 95 C; 35 cycles of 45 sec at 95 ˚C, 1
min at 55 ˚C, and 45 sec at 72 ˚C; and a final 7 min of elongation at 72 ˚C. Reactions were then held at 4 ˚C.

Agarose gel electrophoresis

The amplified products were separated on 1.5% agarose gel electrophoresis. Agarose gel
electrophoresis was conducted in 0.5 X TAE buffer at 80V and 100 mA for 3.5 h. The gels were stained with
ethidium bromide and DNA bands were observed on UV-transilluminator and photographed by a gel
documentation system (VersaDoc/BioRad). A 1 kb DNA ladder (Fermentas) was used to determine the
fragment size.

Data Analysis for SSR and ISSR Markers

SSR and ISSR data were recorded in a binary format, with the presence of a band denoted as "1" and its
absence as "0". Only reproducible bands were scored across all tested genotypes. Genetic relationships among
RÜ and VÜ genotypes were assessed using the unweighted pair-group method with arithmetic mean (UPGMA)
cluster analysis via the PAST software package (Hammer et al. 2001. Bootstrap values for the clusters were
calculated based on 1,000 replicates. The representativeness of the dendrograms was evaluated by calculating
the cophenetic correlation coefficient, r, using Mantel’s matrix correspondence test (Mantel, 1967). This test
compares the cophenetic matrix derived from the dendrogram with the original similarity matrix, measuring
how accurately the dendrogram reflects the similarity data. Cophenetic correlation coefficient supports the
robustness and interpretability of the clustering results, which is essential for drawing meaningful conclusions
in genetic studies. Cophenetic correlation coefficient value close to 1.0 indicates a high degree of fidelity
between the dendrogram and the original data, suggesting that the clustering pattern reliably represents the
underlying genetic relationships. In addition to UPGMA analysis, principal coordinate analysis (PCoA) was
performed to detect genetic associations among the genotypes. A similarity matrix was constructed using
Jaccard coefficients and subsequently used for PCoA. The primers' polymorphism information content (PIC) was
calculated as (Smith et al., 1997) described the following formula, providing a measure of the discriminatory
power of the primers used.

RESULTS AND DISCUSSION

The genetic relationships of 48 Stark Red Gold x Üstün (RÜ) and 48 Venüs x Üstün (VÜ) genotypes
obtained by crossing Stark Red Gold (nectarine), Venüs (nectarine) and Üstün (peach) varieties were
investigated using SSR and ISSR markers.
DNA Isolation
The success of DNA isolation is determined by the quantity, quality, and usability of the extracted DNA
(Şimşek et al., 2008). DNA quality is commonly evaluated using the A260/A280 purity ratio. High-quality DNA
samples typically exhibit a ratio between 1.8 and 2.0. A ratio exceeding 2.0 may indicate contamination by
substances such as RNA, chloroform, or phenol, whereas a ratio below 1.6 suggests the presence of proteins or
phenolic compounds (Hoisington et al. 1992; Şimşek et al. 2008). In this study, A260/A280 ratios measured
using a Nanodrop spectrophotometer following DNA isolation ranged from 1.72 (VÜ82) to 2.23 (VÜ15) in
hybrid VÜ genotypes. Similarly, the ratios for hybrid RÜ genotypes varied between 1.55 (RÜ22) and 2.32
(RÜ87).

SSR Analyses and Polymorphism Assessment

In SSR analyses, 5 primers were used. As a result of the band scoring, the total number of bands
(number), band length intervals (bp), and polymorphism rate (%) were calculated. The band profile table
obtained as a result of the SSR analysis is presented in Table 4.

556
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Table 4. The band profile table obtained as a result of the SSR analysis
Number Primers Total Number Number of Band Polymorphis PIC (%)
of of Bands Polymorphic Length m Rate (%)
Primers (Number) Bands Intervals
(Number) (bp)
1 BPPCT009 3 3 190-200 100 0,91
2 MA014 3 3 165-185 100 0,33
3 BBCT012 1 1 240 100 0,32
4 BBCT008 2 2 150-165 100 0,68
5 BBCT004 3 3 165-185 100 0,85
TOTAL 5 12 12 150-240 100 0,62

Examination of the band profile revealed 12 polymorphic bands, resulting in a 100% polymorphism rate.
The band size ranged from 150 to 240 bp, indicating the high discriminatory power of the analyzed SSR
markers. The PIC values ranged from 0.32 to 0.91, with an average of 0.62. (Wünsch, 2009) studied SSR
markers across 10 different Prunus species, reporting a band size range of 179–272 bp. (Kumar et al., 2023)
reported PIC values ranging from 0.317 to 0.836, with an average of 0.563, in their analysis of 41 peach
genotypes. PIC values provide critical information about the degree of polymorphism among genotypes, with
higher values indicating greater genetic diversity. The relatively high average PIC value observed in this study
underscores the effectiveness of SSR markers in revealing genetic differences among the genotypes. When
comparing the PIC values and SSR marker results with the literature, this study's findings align with those
reported in previous molecular characterization studies, contributing valuable data to the existing body of
knowledge.

Genetic Similarity Analysis Based on SSR Markers

The dendrogram shown in Figure 1 was obtained from the SSR marker analysis. The genetic similarity
coefficients for the parent varieties were as follows: the genetic similarity coefficient between the Stark Red
Gold variety and the Üstün variety was 0.55, while the genetic similarity coefficient between the Venüs variety
and the Üstün variety was 0.50. The genetic similarity coefficient between the Stark Red Gold and Venüs
varieties was 0.75. The genotype most closely related to the Üstün variety is the VÜ82 genotype, with a genetic
similarity coefficient of 0.73. In contrast, the genotypes with the most distant genetic similarity to Üstün are
RÜ11, RÜ13, RÜ71, RÜ80, RÜ81, and VÜ107, all showing a genetic similarity coefficient of 0.22. Regarding the
Venüs variety, the genotype with the closest genetic similarity is VÜ113, with a genetic similarity coefficient of
1.00, indicating complete similarity. The genotypes with the most distant genetic similarity to Venüs are VÜ112,
VÜ103, VÜ86, RÜ22, and RÜ19, all with a genetic similarity coefficient of 0.29. For the Stark Red Gold variety,
the genotype with the closest genetic similarity is VÜ24, also showing 100% similarity with a genetic similarity
coefficient 1.00. The genotypes with the most distant genetic similarity to Stark Red Gold are RÜ22, VÜ86,
VÜ103, and VÜ112, with a genetic similarity coefficient of 0.22. Genetic similarity coefficients among the
genotypes ranged from 0.10 to 1.00. The most distant genotypes, with a genetic similarity coefficient of 0.10,
were RÜ74 and VÜ6.

557
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Figure 1. Dendrogram generated using UPGMA, showing relationships between RÜ and VÜ hibrids, using SSR
data.

558
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

The PCoA analysis graph, presented in Figure 2, was generated based on SSR data. The hybrid RÜ and VÜ
genotypes were observed to be distributed homogeneously across both the negative and positive regions of
the coordinate. This two-dimensional graph explained 15% of the total molecular variation between genotypes
in the first dimension, while the second dimension accounted for 17% of the total molecular variation.

Figure 2. Principle Coordinate Analysis (PCo) based on SSR data

ISSR Analysis and Polymorphism Assessment

Fourteen ISSR primers were used in this study. The band profile table obtained as a result of the ISSR
analysis is presented in Table 5.

Table 5. The band profile table obtained as a result of ISSR analysis

No Primers Total Number Number of Band Length Polymorphism PIC
Code of Bands Polymorphic Intervals Rate (%) (%)
(Number) Bands (bp)
(Number)
1 UBC 807 13 13 300 - 1400 100 0,35
2 UBC808 13 8 300 - 1500 61 0,30
3 UBC810 16 16 300 - 1400 100 0,54
4 UBC811 15 15 300 - 2000 100 0,82
5 UBC 812 10 9 300 - 1400 90 0,43
6 UBC815 10 10 500-1500 100 0,81
7 UBC816 13 9 350 - 1700 69 0,75
8 UBC818 13 13 300 - 1650 100 0,76
9 UBC820 6 5 900 - 1700 83 0,74
10 UBC827 8 8 400 - 1300 100 0,75
11 UBC834 20 20 300 - 1000 100 0,86
12 UBC835 10 10 300 - 1300 100 0,38
13 UBC845 8 8 300 - 1200 100 0,73
14 UBC850 8 6 1000 - 2000 75 0,84
TOTAL 14 163 150 300 - 2000 91 0,65

559
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

A total of 9 primers out of the 14 primers analyzed showed 100% polymorphism. Primers showing 100%
polymorphism were UBC807, UBC810, UBC811, UBC815, UBC818, UBC827, UBC834, UBC835, UBC845. 14
specific ISSR primers produced 163 bands, 150 of which were polymorphic, resulting in a polymorphism rate of
91%. The total number of bands obtained per primer varied between 6-20 (average 13 bands/primer), and the
total number of polymorphic bands varied between 5-20 (average 12.5 bands/primer). The total polymorphism
rate was calculated as 90%. The band size range varied between 300 and 2000 bp. Li et al. (2023) performed a
genetic characterization study on 39 peach genotypes using ISSR and SRAP markers. Their study included 18
ISSR primers, four of which (UBC811, UBC812, UBC834, UBC835) were also used in this research. The
polymorphism rates for these primers in their study were 66.67%, 70%, 75%, and 50%, respectively. The
polymorphism rates observed in this study for the same primers were 100%, 90%, 100%, and 100%,
respectively. These differences are attributed to genetic variation between the studied genotypes. The findings
highlight the high reliability of these primers as markers for genetic characterization in this study's genotypes.
Mahmood et al. (2023) examined 12 almond genotypes using RAPD and ISSR markers, reporting an average of
7.6 polymorphic bands in their ISSR analysis. The PIC values of their ISSR primers ranged from 0.52 to 0.91.
They also evaluated the UBC812 primer, assigning it a PIC value of 0.80. In contrast, this study found PIC values
for ISSR primers ranging between 0.30 and 0.86, with the UBC812 primer yielding a PIC value of 0.43. This
lower PIC value may result from using hybrid genotypes in this study, which generally exhibit reduced genetic
diversity compared to distinct varieties. Despite some variations in PIC values, the ISSR marker systems
analyzed in this study demonstrated significant discriminatory capacity and produced consistent, reliable
results.

Genetic Similarity Analysis Based on ISSR Markers

The dendrogram shown in Figure 3 was obtained from the ISSR marker analysis. The similarity matrix
derived from the ISSR analysis revealed that the genetic similarity coefficient between the Venüs and Üstün
varieties was 0.85. The genotype most closely related to the Üstün variety is VÜ15, with a genetic similarity
coefficient of 0.84. In contrast, the genotype with the least genetic similarity to Üstün is RÜ5, with a similarity
coefficient 0.30. Similarly, for the Venüs variety, the genotypes VÜ65 and VÜ24 exhibited the highest genetic
similarity, with a coefficient of 0.85, while the genotype RÜ12 showed the most distant genetic similarity, with
a coefficient of 0.29. For the Stark Red Gold variety, genotype RÜ8 exhibited the closest genetic similarity, with
a coefficient of 0.71, whereas the most distant genotype was VÜ41, with a coefficient of 0.29. The genetic
similarity coefficients among the genotypes ranged from 0.20 to 0.95. The genotypes with the least genetic
similarity were RÜ12 and RÜ41, with a similarity coefficient of 0.20, while the genotypes with the closest
genetic similarity were VÜ92 and VÜ86, with a coefficient of 0.95. These results highlight the genetic diversity
among the genotypes and the discriminative power of the ISSR marker system. In a study by Goulão et al.
(2001), molecular characterization was performed using AFLP and ISSR markers in plum, and the cophenetic
correlation coefficient was reported as 0.73 In our study, 14 ISSR primers were used to analyze the VÜ and RÜ
genotypes, and the cophenetic correlation coefficient was found to be 0.82. This high coefficient indicates a
strong unity between the similarity matrix and dendrogram, validating the genetic relationships observed.

560
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Figure 3. Dendrogram generated using UPGMA, showing relationships between RÜ and VÜ hibrids, using ISSR
data.

561
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

The PCoA analysis graph, presented in Figure 4, was generated based on ISSR data. The genotypes were
distributed evenly across both the negative and positive regions of the coordinate. The two-dimensional graph
in Figure 2 explains 21% of the total molecular variation between genotypes in its first and 28% in its second
dimensions.

Figure 4. Principle Coordinate Analysis (PCo) based on ISSR data

Cluster analysis based on genetic diversity is the base of plant breeding is one of the important
components of biological systems stability. Evaluating genetic diversity in plants for plant breeding programs
and heritable resources protection has a vital usage (Ahmadizadeh et al. 2011). The clustering patterns
observed through SSR and ISSR analyses offer valuable insights into the genetic structure and diversity of the
studied genotypes. In this study, the SSR-based dendrogram revealed that the VÜ-103 genotype was
genetically distinct from all other genotypes, indicating a unique genetic background that may be valuable for
broadening the genetic base in breeding programs. On the other hand, ISSR markers, demonstrated a clear
separation between the VÜ and RÜ genotypes. This suggests a strong genetic divergence between the two
groups, which can be strategically utilized to enhance genetic variability through inter-group hybridization.

CONCLUSION
This study investigated the molecular characterization and genetic relationships of peach and nectarine
cultivars and their hybrids using 5 SSR and 14 ISSR markers. When comparing the current study's SSR and ISSR
analysis data with existing literature, the results emphasized the high discriminatory power of the primers
used. These primers proved effective in peach and nectarine genetics and breeding. Future studies should
consider increasing the number of primers to gain more comprehensive genetic information about the
genomes of Prunus varieties and hybrids. It is also recommended that hybrid individuals be evaluated with
molecular data alongside morphological, phenological, pomological, and other traits over the long term. In
future breeding efforts, crossbreeding distant genotypes will enhance genetic variation, with molecular data
crucial in developing new breeding materials.

Acknowledgements
This study was supported by the Çukurova University Scientific Coordination Unit (Project No: FYL-2023-
15942). The plant material used in this study was obtained from the PRIMA project (Project No: 118O855).
Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could
have appeared to influence the work reported in this paper

562
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Author Contributions
A. B: Performing all analyses, statistical analyses & writing; D.D.: Performing a part of analysis and statistical
analyses & editing; S.Ç: Data analysis-review, editing; A.B.K.: Review, editing; Y.A.K.: Supervising, designing of
the study, data analysis-writing & editing,

ORCID
Aycan BAYAV https://orcid.org/0009-0003-4320-7175
Dicle DÖNMEZ https://orcid.org/0000-0002-7446-9405
Songül ÇÖMLEKÇİOĞLU https://orcid.org/0000-0003-1275-4574
Ayzin KÜDEN https://orcid.org/0000-0002-0811-6695
Yıldız AKA KAÇAR https://orcid.org/0000-0001-5314-7952

Article History
Submission received: 13.05.2025
Revised: 01.07.2025
Accepted: 03.07.2025

REFERENCES

Ahmadizadeh, M., Nori, A., Shahbazi, H., & Habibpour, M. (2011). Effects of drought stress on some agronomic
and morphological traits of durum wheat (Triticum durum Desf.) landraces under greenhouse condition.
African Journal of Biotechnology, 10(64), 14097-14107.
Aka Kaçar, Y. (2004). Using of molecular markers in Prunus species. Alatarım, 3(2), 15-22.
Aka Kaçar, Y., Lezzoni, A.F., & Çetiner, S. (2005). Sweet cherry cultivar identification by using SSR markers.
Journal of Biological Sciences, 5(5), 616-619. https://doi.org/10.3923/jbs.2005.616.619
Aka Kacar, Y., Simsek, O., Donmez, D., Boncuk, M., Yeşiloğlu, T., & Ollitrault, P. (2014). Genetic relationships of
some Citrus genotypes based on the candidate iron chlorosis genes. Turkish Journal of Agriculture and
Forestry, 38, 340–347. https://doi.org/10.3906/tar-1301-15
Akçura, M. (2011). The relationships of some traits in Turkish winter bread wheat landraces. Turkish Journal of
Agriculture and Forestry, 35(2), 115-125. https://doi.org/10.3906/tar-0908-301
Akcura, M., Turan, V., Kokten, K., & Kaplan, M. (2019). Fatty acid and some micro element compositions of
cluster bean (Cyamopsis tetragonoloba) genotype seeds growing under Mediterranean climate.
Industrial Crops and Products, 128, 140-146.
Anonymous (2025). Türkiye Hayvansal üretim istatistikleri. https://data.tuik.gov.tr/Bulten/Index?p=Hayvansal-
Uretim-Istatistikleri-2024-53935 (Accessed date: 10.02.2025)
Anonymous, (2019). Food and Agriculture Organization of the United Nations (FAO), http://www.fao.org/site,
(Accessed date: 13.11.2018)
Çömlekçioğlu, S. (2014). Identification of plant characteristics of nectarine and peach hybrids and usability of
some ssr markers in early selection. (Ph. D. Thesis) Cukurova University. The Institute of Natural
Sciences, Adana, Türkiye.
Domblides, A., & Domblides, E. (2023). Rapid genetic assessment of carrot varieties based on AFLP analysis.
Horticulturae, 9(3), 298. https://doi.org/10.3390/horticulturae9030298
Dosba, F. (2002). Progress and prospects in stone fruit breeding. In XXVI International Horticultural Congress:
Genetics and Breeding of Tree Fruits and Nuts, 622, 35-43.
Edwards. K., Johnstone, C., & Thompson, C. (1991). A simple and rapid method for the preparation of plant
genomic DNA for PCR analysis. Nucleic Acids Research, 19(6), 1349.
https://doi.org/10.1093/nar/19.6.1349
Eroğlu, Z.Ö., & Mısırlı, A. (2012). Peach breeding and development. Bahce, 41(2), 37-46.
Filiz, E., & Koç, İ. (2011). Molecular markers in plant biotechnology. Journal of Agricultural Faculty of
Gaziosmanpasa University, 2, 207-214.
Genişel, H. (2013). Characterization of new putative species crocus (Colchicum L.) in Turkey’s flora using ISSR
markers. (MSc Thesis) Istanbul University. Institute of Science, İstanbul, Türkiye.
Goulão, L., Monte-Corvo, L., & Oliveira, C.M. (2001). Phenetic characterization of plum cultivars by high
multiplex ratio markers: Amplified fragment length polymorphisms and inter-simple sequence repeats.
Journal of the American Society for Horticultural Science, 126(1), 72-77.

563
 Turkish Journal of Agricultural and Natural Sciences 12 (3): 552–564, 2025

Güleç, T.E., Yıldırım, A., & Sönmezoğlu, Ö.A. (2010). Marker assisted selection in plants. Turkish Journal of
Scientific Reviews, 2, 67-79.
Hammer, D.A.T., & Harper, P.D.R. (2001). Past: paleontological statistics software package for education and
data analysis. Palaeontologia Electronica, 4(1), 4-9.
Hoisington, M.A., Seferis, J.C., & Thompson, D. (1992). Scale-up for hot melt prepreg manufacturing. In 37th
International SAMPE Symposium and Exhibition. 264-277.
Kaynaş, K., Alkın, G., & Çiftci, H.N. (2022). Effects of 1-methylcyclopropane and modified atmosphere packaging
on quality characteristics in storage of ANET 30 peach varieties. COMU Journal of Agriculture Faculty,
10(1), 99-107.
Kumar, R., Dimri, D.C., Karki, K., Rai, K.M., Singh, N.K., Shivran, J.S., & Bharti, S. (2023). SSR marker based
profiling and population structure analysis in peach (Prunus persica) germplasm. Indian Journal of
Agricultural Sciences, 93(10), 1080-1085. https://doi.org/10.56093/ijas.v93i10.132658
LaRue, J. (1989). Introduction. In: LaRue, JH, Johnson RS (eds) Peaches, plums, and nectarines: growing and
handling for fresh market. Publication No 3331. University of California, Division of Agriculture and
Natural Resources, Oakland, California, pp. 1-2.
Li, W., Ma, Y., Kou, Y., Zeng, Z., Qiu, D., & Ma, C. (2023). Analysis of genetic diversity and relationships between
late-mature peach (Prunus persica L.) varieties assessed with ISSR and SRAP markers. Fruit Research,
3(36), 1-10. https://doi.org/10.48130/FruRes-2023-0036
Mahmood, A.M., Faraj, J.M., Sharef, A.A., Majeed, H.O., Hamasalih, F.M., & Tahir, N.A. (2023). Evaluation of
wild almond genotypes grown as a rain-fed crop in sulaimani governorate using RAPD and ISSR markers.
Kufa Journal for Agricultural Sciences, 15(1), 19-33.
Mantel, N. (1967). The detection of disease clustering and a generalized regression approach. Cancer Research,
27, 209-220.
Mirik, M. (2005). Biberde bakteriyel leke etmeni Xanthomonas axonopodis pv. vesicatoria’nın tanılanması ve
bitki büyüme düzenleyici rizobakteriler ile biyolojik mücadele olanakları. (Ph. D. Thesis) Cukurova
University. The Institute of Natural Sciences, Adana, Turkey
Mohsenin, N.N. (1970). Physical Properties of Plant and Animal Materials. Gordon and Breach Science
Publishers, New York
Okie, W.R., Bacon, T., & Bassi, D. (2008). Fresh market cultivar development. The peach: Botany, production
and uses. CABI, Cambridge, 139-174.
Powell, W., Machray, G.C., & Provan, J. (1996). Polymorphism revealed by simple sequence repeats. Trends in
Plant Science, 1(7), 215-222.
Saglam, C., & Tan, F. (2017). An Environmentally Friendly Method of Fertilizer Application in Agriculture;
Anhydrous Ammonia Application. International Conference on Environment and Natural Science.
(ICENS). 9-10 September, P.7-9. Moscow, Russia.
Sang, Q., Zhou, Z., Mu, J., & Wang, L. (2021). Genetic factors as potential molecular markers of human oocyte
and embryo quality. Journal of Assistant Reproduction and Genetics, 38(5), 993-1002.
https://doi.org/10.1007/s10815-021-02196-z
Schulman, A.H. (2007). Molecular markers to assess genetic diversity. Euphytica, 158(3), 313-321.
Şimşek, Ö., Karaat, F.E., Serçe, S., & Aka Kaçar, Y. (2008). Comparison of the efficiency of DNA isolation
methods in some fruit species. Derim, 25(1), 59-69.
Smith, J.S.C., Chin, E.C.L., Shu, H., Smith, O.S., Wall, S.J., Senior, M.L., & Ziegle, J. (1997). An evaluation of the
utility of SSR loci as molecular markers in maize (Zea mays L.): comparisons with data from RFLPs and
pedigree. Theoretical and Applied Genetics, 95(1–2), 163–173.
Wünsch, A. (2009). Cross-transferable polymorphic SSR loci in Prunus species. Scientia Horticulturae, 120, 348-
352. https://doi.org/10.1016/j.scienta.2008.11.012
Yang, K., Chen, D.H., Ding, X., Li, J., Zhang, Y.Q., Zhang, T., et al., Wang, X.M. (2023). Different roles of primary
and secondary sources in reducing PM2. 5: Insights from molecular markers in Pearl River Delta, South
China. Atmospheric Environment, 294, 119487. https://doi.org/10.1016/j.atmosenv.2022.119487
Yorgancılar, M., Yakışır, E., & Erkoyuncu, M.T. (2015). Using of molecular markers in plant breeding. Journal
Bahri Dagdas Herbal Research, 4(2), 1-12.
Yu, W., Peng, F., Wang, W., Liang, J., Xiao, Y., & Yuan, X. (2021). SnRK1 phosphorylation of SDH positively
regulates sorbitol metabolism and promotes sugar accumulation in peach fruit. Tree Physiology, 41(6),
1077-1086. https://doi.org/10.1093/treephys/tpaa163
Yüce, M. (2018). Determination of performance of some peach and nectarine varieties in ecological conditions
of Kahramanmaraş province. (MSc Thesis) Kahramanmaraş Sütçü İmam University, Institute of Science,
Kahramanmaraş, Türkiye.

564