0% found this document useful (0 votes)
17 views4 pages

Biology Test Paper PDF

The document is a biology exam paper for the year 2026, containing multiple choice questions, short answer questions, and long answer questions. It covers various topics in biology including reproductive biology, genetics, and molecular biology. The exam is structured into different sections, each with specific types of questions and marks allocation.

Uploaded by

cellmax692007max
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
17 views4 pages

Biology Test Paper PDF

The document is a biology exam paper for the year 2026, containing multiple choice questions, short answer questions, and long answer questions. It covers various topics in biology including reproductive biology, genetics, and molecular biology. The exam is structured into different sections, each with specific types of questions and marks allocation.

Uploaded by

cellmax692007max
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 4

Complete Subjective Test - 01 PARISHRAM 2026 14/09/2025

BIOLOGY
Section-A (A) P-(III), Q-(II), R-(I), S-(IV)
Multiple Choice Type Questions [1 Mark Each] (B) P-(IV), Q-(I), R-(III), S-(II)
1. Identify the correct labelling (P), (Q), (R), (S) and (C) P-(IV), Q-(I), R-(II), S-(III)
choose the correct option. (D) P-(II), Q-(IV), R-(I), S-(III)
GnRH 4. Which one of the following is the sequence on
corresponding coding strand, if the sequence on
LH (P) mRNA formed is as follow:
  5'AUCGAUCGAUCGAUCGAUCGAUCGAUC
(Q) (R) G 3'?
  (A) 3' ATCGATCGATCGTCGATCGATCGAT
Androgens Factors CG 5'
  (B) 5' UAGCUAGCUAGCUAGCUAGCUAGC
Formation of spermatids (S) UAGC 3'
(A) FSH, Sertoli cells, Leydig cells, Spermatogenesis. (C) 3' UAGCUAGCUAGCUAGCUAGCUAGC
(B) ICSH, Leydig cells, Sertoli cells, UAGC 5'
Spermatogenesis. (D) 5' ATCGATCGATCGATCGATCGATCGA
(C) FSH, Leydig cells, Sertoli cells, Spermiogenesis TCG 3'
(D) ICSH, Interstitial cells, Leydig cells,
Spermiogenesis. 5. Identify the correct description about the given
figure.
2. Arrange the components of mammary gland (from
proximal to distal).
P. Mammary duct
Q. Lactiferous duct
R. Alveoli
S. Mammary ampulla
(A) Wind pollinated plant inflorescence showing
T. Mammary tubules
flowers with well exposed stamens.
Choose the most appropriate answer from the
(B) Compact inflorescence showing complete
options given below. autogamy.
(A) T → R → S → Q → P (C) Cleistogamous flowers showing autogamy.
(B) R → P → S → T → Q (D) Water pollinated flowers showing stamens
(C) Q → R → T → S → P with mucilaginous covering.
(D) R → T → P → S → Q
6. In angiosperms the correct sequence of events in
3. Match List-I with List-II with respect to methods formation of female gametophyte in the ovule is:
of Contraception and their respective actions. P. 3 successive free nuclear divisions in
functional megaspore.
List-I List-II
Q. Degeneration of 3 megaspores.
(P) Diaphragms (I) Inhibit ovulation and
R. Meiotic division in megaspore mother cell.
Implantation
S. Migration of 3 nuclei towards each pole.
(Q) Contraceptive (II) Increase phagocytosis
T. Formation of wall resulting in seven celled
Pills of sperm within Uterus
embryo sac.
(R) Intra Uterine (III) Absence of Menstrual Choose the correct answer from the options given
Devices cycle and ovulation below:
following parturition (A) (P), (Q), (R), (S), (T)
(S) Lactational (IV) They cover the cervix (B) (R), (Q), (P), (S), (T)
Amenorrhea blocking the entry of (C) (Q), (R), (P), (S), (T)
sperms (D) (R), (T), (P), (S), (Q)

[1]
7. Select the incorrect match regarding the symbols Section-B
used in Pedigree analysis Short Answer Type Questions [3 Marks Each]
11. Answer the following questions.
(A) Parent with male child affected with
(a) The below diagrams are related to castor seeds.
disease Identify P, Q, and R respectively. [1]

(B) Sex unspecified

(C) Affected individual

(D) Consanguineous mating

8. Assertion: Francis Crick proposed the Central


dogma in molecular biology, which states that the (b) Draw well labelled diagram showing process of
genetic information flows from DNA → RNA → transcription in eukaryotes. [2]
Protein.
Reason: Euchromatin is said to be transcriptionally
12. Answer the following questions.
active chromatin, whereas heterochromatin is
inactive. (a) Identify the birth control methods or devices in given
(A) Both assertion and reason are true and reason diagrams (P), (Q), (R) and (S) respectively. [1]
is the correct explanation of assertion.
(B) Both assertion and reason are true but reason (P) (Q)
is not the correct explanation of assertion.
(C) Assertion is true but the reason is false.
(D) Assertion is false but the reason is true.

9. Assertion: If the female parent has bisexual


flowers, emasculation is required, which involves (R) (S)
removing the anthers from the flower bud with
forceps before they dehisce.
Reason: Albuminous seeds retain a part of (b) Draw a well-labelled diagram showing a sectional
endosperm as it is not completely used up during view of the fallopian tube and the layers of the
embryo development.
uterus in the female reproductive system. [2]
(A) Both assertion and reason are true and reason
is the correct explanation of assertion.
(B) Both assertion and reason are true but reason 13. Answer the following questions.
is not the correct explanation of assertion. (a) Identify (P), (Q), (R) and (S) respectively in the
(C) Assertion is true but the reason is false. given diagram. [1]
(D) Assertion is false but the reason is true.

10. Assertion: Intra cytoplasmic sperm injection


(ICSI) is a specialized lab procedure where a sperm
is directly injected into an ovum to form an embryo.
Reason: Apart from hepatitis-B, genital herpes,
and HIV infections, other STDs are not curable, (b) Differentiate between Phenylketonuria and
even if detected early and treated properly.
Down’s Syndrome based on cause and symptoms.
(A) Both assertion and reason are true and reason
is the correct explanation of assertion. [2]
(B) Both assertion and reason are true but reason OR
is not the correct explanation of assertion. Differentiate between Haemophilia and
(C) Assertion is true but the reason is false. Thalassemia based on cause and symptoms. [2]
(D) Assertion is false but the reason is true.
[2]
Section-C 16. Answer the following questions.
Long Answer Type Questions [5 Marks Each] (a) Explain how apomixis occurs in some plants. [1]
14. Answer the following questions.
(a) Describe the structure of tRNA in protein (b) Draw a schematic representation of spermatogenesis.
synthesis. [2] [2]
OR OR
Explain the process of DNA replication, focusing Draw a schematic representation of oogenesis. [2]
on the role of the replication fork, DNA
polymerases and the formation of Okazaki (c) How did O. Avery, C MacLeod and M. McCarty
fragments. [2] prove that DNA was the genetic material? Explain.
[2]
(b) Draw a diagrammatic representation of a typical
anatropous ovule. [2] Section-D
Case Study Based Question [2 Marks Each]
(c) What are the provisions of the Medical 17. Translation refers to the process of polymerisation
Termination of Pregnancy (Amendment) Act,
of amino acids to form a polypeptide. The order
2017, and how does it address the issue of illegal
and sequence of amino acids are defined by the
abortions? [1]
sequence of bases in the mRNA. The amino acids
are joined by a bond which is known as a peptide
15. Answer the following questions.
bond. Formation of a peptide bond requires energy.
(a) Study the figure given below and answer the
Therefore, in the first phase itself amino acids are
questions:
activated in the presence of ATP and linked to their
cognate tRNA.
(i) What is a translational unit in mRNA? Explain the
role of untranslated regions (UTRs) in mRNA.

(i) What enzyme is transcribed by the gene 'z' in (ii) Briefly describe the process of elongation in
the lac operon system? [½] protein synthesis.
(ii) How does the repressor molecule get
inactivated and when does the transcription of 18. The chorionic villi and uterine tissue become
lac mRNA stop? [1½] interdigitated with each other and jointly form a
structural and functional unit between developing
(b) How do LH and FSH contribute to ovulation during embryo (foetus) and maternal body called placenta.
the menstrual cycle? [1] The average duration of human pregnancy is about
9 months which is called the gestation period.
(c) A red-eyed heterozygous female fruit fly is crossed Delivery of the foetus (childbirth) is called
with a red-eyed male. Work out all possible parturition.
genotypes and phenotypes of the progeny. [2] (i) What is the role of the placenta in hormone
OR
production during pregnancy?
Explain the phenomena of dominance, multiple
allelism and co-dominance taking ABO blood
(ii) Briefly explain the neuroendocrine mechanism
group as an example. [2]
involved in parturition.
[3]
19. Variations in the DNA sequence are what make (i) Who developed the technique of DNA
each individual unique in terms of their phenotype. fingerprinting and what method did he use to
Sequencing DNA to identify genetic differences identify genetic polymorphism?
between individuals or populations would be time-
consuming and costly. DNA fingerprinting offers a (ii) How does repetitive DNA contribute to DNA
fast and affordable method to compare the genetic fingerprinting, and how is satellite DNA classified?
sequences of two individuals.

PW Web/App- https://smart.link/7wwosivoicgd4
Library- https://smart.link/sdfez8ejd80if

[4]

You might also like