Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.

ly
Medical Research Mediterr J Med Res

ORGINAL RESEARCH article

Fungicidal action of endophytic fungi, obtained from Justicia carnea, against

multidrug-resistant Candida albicans
Miriam G.U. Nwaneri 1 , Loveline N. Umeugoji 1 , and Udochi A. Ugo 2 *
1
Department of Pharmaceutical Microbiology and Biotechnology, Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe
University, Awka 420112, Anambra State, Nigeria
2
Department of Pharmaceutical Microbiology and Biotechnology, Faculty of Pharmaceutical Sciences, University of Nigeria,
Nsukka, Enugu State, Nigeria
*
Author to whom correspondence should be addressed

Received: September 02, 2025, Accepted: October 25, 2025, Published online: October 27, 2025

Copyright© 2025. This open-access article is distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

HOW TO CITE THIS

Nwaneri MGU, et al. Fungicidal action of endophytic fungi, obtained from Justicia carnea, against
multidrug-resistant Candida albicans. Mediterr J Med Res. 2025; 2(4): 179-185.
[Article number: 23]. https://doi.org/10.5281/zenodo.17449274

Keywords: DNA sequence, endophytic fungi, multi-drug resistant, Sordariomycetes

Abstract: Candida albicans causes high morbidity and mortality and is becoming a danger to public health.
The problem created by its high occurrence and the treatment failures cannot be overstated. Endophytes
derived from some medicinal plants serve as a new source of drug discovery. This study is aimed at evaluating
the fungicidal potential of endophytic fungi obtained from Justicia carnea against multidrug-resistant
Candida albicans. Candida albicans were obtained from clinical samples at Nnamdi Azikiwe Teaching
Hospital in Anambra State, Nigeria. The susceptibility study to isolate multi-drug-resistant Candida albicans
with antifungal agents was determined using the Kirby-Bauer technique. The isolation and extraction of fungal
metabolites were carried out. The fungicidal activity of the metabolites against multi-drug-resistant Candida
albicans was studied using in vitro method. Molecular characterization of endophytic was carried up to the
species level. The findings have established that Candida albicans species are becoming resistant to
fluconazole, followed by miconazole, within the environment. The leaves of Justicia carnea produced a high
yield of secondary metabolites. These metabolites have significant antifungal effects against the isolates of
multi-drug-resistant Candida albicans up to a concentration of 18.8 mg/ml. The DNA sequence of the
endophytic fungi isolate is the same as Sordariomycetes sp. This study indicates that Justicia carnea harbors
endophytic fungi with biosynthetic capacities for a new bioactive agent.

Introduction
Candida albicans is a versatile and opportunistic fungus that normally exists in the human microbiome without
causing harm [1]. However, under specific conditions, it can lead to various infections, from minor skin issues
to severe systemic infections [2-4]. It causes high morbidity and mortality globally [5-7] and is becoming a
serious threat to public health [8]. Candida albican is becoming resistant to many antifungals [3, 9, 10], and
the obtainability of antifungal drugs to treat people with candida infections is inadequate [11]. The problem
created by the rising occurrence of Candida albican and failures in the treatment of its infections cannot be
overestimated. As such, there is a need for the development of an alternative therapy that is easily accessible
to support the antifungal agent. In a continuous search of new products, a study of endophytic fungi isolated
from Justicia carnea, a flamingo plant, was carried out. This study is aimed at evaluating the fungicidal
potential of endophytic fungi gotten from Justicia carnea against multidrug-resistant candida albicans.

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 179
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

Materials and methods

Plant material: Fresh and healthy leaves of Justicia carnea were harvested in February 2022 from the
botanical garden of the Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University, Agulu campus,
Anambra State, South-Eastern Nigeria. The leaves were identified and authenticated by a plant taxonomist at
the Department of Pharmacognosy and Traditional Medicine in the same University.
Culture media and drugs: Sabouraud dextrose agar (SDA), potato dextrose agar and sabouraud dextrose broth
(Titan Biotech. Limited, India) were the culture media used. These media were prepared according to the
manufacturer’s instructions. Miconazole (2.0 mg), fluconazole (2.0 mg) and chloramphenicol (500 mg/L)
(Titan Biotech. Ltd; India) were the antifungal and antibacterial agents used.
Test organism: A total of 20 isolates of Candida albicans were obtained from clinical samples at Nnamdi
Azikiwe Teaching Hospital in Anambra State. An approval for these samples was obtained from the hospital
Committee. The isolates were obtained from high vaginal swabs. Each of these strains were reconfirmed by
macroscopy, microscopy and biochemical test, such as sugar utilization test/Glucose test and Germ tube test
[12-14] and stored in Sabouraud dextrose broth at 25oC.
Isolation of multi-drug-resistant Candida albicans: The susceptibility study of the Candida albicans isolates
with the antifungal agents was determined using the Kirby-Bauer technique as follows. 0.1 ml of standardized
Candida albicans cultures was diluted with distilled water to get the turbidity match of 0.5 McFarland
standards and dispersed evenly into SDA plates using a sterile swab stick to make a lawn. Inoculated plates
were allowed to dry. A sterile cork borer was used to bore five wells of size 8.0 mm in the plates. Using a
micropipette, 80 µl of each concentration was put into the wells and the plates were allowed for a period of
30 min and then incubated at 25°C for two days. The zone of inhibition was observed, and the diameter of the
zone was measured and recorded (Figure 1). The organisms that showed resistance to the antifungal agents
were isolated as MDR Candida albicans [15].

Figure 1: Inhibition zones produced by Sordariomycetes spp crude extract against Candida spp.

A B C
Key: A: Isolate 1; B: Isolate 2; C: Isolate 3

Isolation of endophytic fungi: The leaves of Justicia carnea were washed with water, disinfected with 2.5%
sodium hypochlorite and 70.0% ethanol. They were aseptically cut to 2.0 cm and inoculated onto sterile PDA
plates containing chloramphenicol. These plates were incubated for five days at 25oC while observing the
development of mycelium. Isolation of pure cultures was attained by continuous sub-culturing of isolates on
fresh PDA. Colonial/morphological characteristics of the fungal isolates were carried out by observing the
colony texture, color and pigmentation [16, 17].

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 180
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

Extraction of metabolites: Each pure fungal isolate was grown in 1.0 L Erlenmeyer flasks with sterilized rice
medium, previously autoclaved for one hour at 121ºC at 15 psi [13]. The fermentation flasks were sealed and
incubated under static conditions for 21 days at 28°C. Extraction of the fungal metabolites was attained using
ethyl acetate. The filtrates were concentrated by evaporating the solvent at 40ºC using a rotary evaporator.
Determination of fungicidal activity: The antifungal effects of the endophytic fungal extracts were tested in
vitro against a test culture of multidrug-resistant Candida albicans as follows. The suspensions of test
organisms were adjusted to 0.5 McFarland turbidity standards and inoculated onto previously sterile SDA
plates using sterile cotton swabs. A sterile cork borer was used to make five wells (8.0 mm in diameter) on
each of the SDA plates. Aliquots of 80 μl of each dilution of the extract reconstituted in DMSO at different
concentrations were put in each of the wells. Fluconazole (100 mg/mL) served as the positive control. The
plates were then incubated at 25oC for 48 hrs. The antimicrobial potential for each extract was determined by
measuring the zone of inhibition around each well. The assay was carried out in duplicates and the mean IZD
was used [18].
Isolation of DNA and polymerase chain reaction (PCR): DNA isolation and amplification was done to
characterize the endophytic fungi up to the species level. The genomic DNA of endophytic fungi was extracted
and quantified using Quick-DNATM Fungal/Bacterial Miniprep Kit (Zymo Research), as laid-out in the
endorsed protocols with minor modification. The PCR amplifications were undertaken in a 25.0 μl reaction
volume (reaction mixture) comprising of 12.5 μl of One Taq Quick-Load 2X Master Mix with standard buffer,
0.5 μl each of forward and reverse primers, 9.0 µl of Nuclease free water and 3.0 μl es of DNA template. The
reaction was gently mixed and transferred to a thermal cycler. The PCR cycling conditions were in the order:
Initial denaturation at 94oC lasted for 30 sec, followed by 35 cycles of denaturation at 94oC for 20 sec, primer
annealing at 54oC for 45 sec and strand extension at 72oC for one minute. Final extension at 72oC for five min
on an Eppendorf Nexus gradient Mastercycler. PCR products were separated on a 1.5% agarose gel and DNA
bands were visualized with ethidium bromide [15].
Sequencing: PCR products were cleaned using EXOSAP protocol whereby EXOSAP mix was prepared by
the addition of Exonuclease 1 (20.0 U/μl 50.0 μl) and shrimp alkaline phosphatase (1.0 U/μl 200 μl). Amplified
PCR product 10.0 μl EXOSAP and 2.5 μl were mixed and incubated at 37oC for 15 min. The reaction was
stopped by heating the mixture at 80oC for 15 min. Fragments were sequenced using Nimagen, Brilliant Dye
Terminator cycle sequencing kit, according to the manufacturer’s instructions.

Results
Susceptibility study of the isolates with antifungal agents: The sensitivity of Candida albicans to these two
standard drugs (Fluconazole and Miconazole) revealed that the drugs have no activity on most of the isolates,
indicating the resistance of the organisms to these drugs (Tables 1 and 2).

Table 1: Inhibition zone diameter of miconazole against isolates of Candida albicans

Concentration
Isolates
(µg/mL)
1 2 3 4 5 6 7

300 8±0 4±0 0±0 0±0 0±0 0±0 0±0

150 5±0 0±0 0±0 0±0 0±0 0±0 0±0
75 0±0 0±0 0±0 0±0 0±0 0±0 0±0
37.5 0±0 0±0 0±0 0±0 0±0 0±0 0±0
18.8 0±0 0±0 0±0 0±0 0±0 0±0 0±0

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 181
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

Table 2: Inhibition zone diameter of fluconazole against isolates of Candida albicans

Concentration (µg/mL) Isolates
1 2 3 4 5 6 7
300 0±0 0±0 0±0 0±0 0±0 0±0 0±0
150 0±0 0±0 0±0 0±0 0±0 0±0 0±0
75 0±0 0±0 0±0 0±0 0±0 0±0 0±0
37.5 0±0 0±0 0±0 0±0 0±0 0±0 0±0
18.8 0±0 0±0 0±0 0±0 0±0 0±0 0±0

Extraction of metabolites: The colonial features and yield of endophytic fungi isolated from the leaf blade of
Justicia carnea is presented in Table 3.

Table 3: Colonial features and yield of fungal extracts

Isolate code Colour Texture Pigment Yield (g)
PLB White and light green Cottony No pigment 4.0
Key: PLB - Plant leaf blade

Determination of fungicidal activity: The antifungal assay results obtained exhibited that the extract has
activity on most of the isolates based on their concentrations (Table 4 and Figure 2).

Table 4: Inhibition zone diameter of the extract against Candida albicans

Concentration Isolates
(mg/mL) 1 2 3 4 5 6
150 9±0 13±0.7 13±0 12±0 7±0 12±0.7
75 8±0 12.5±0 12±0.7 7±0 5.5±0.7 4.5±0.7
37.5 5.5±0 9±0.7 10±0 0±0 3.5±0.7 0±0
18.8 2.5±0 4.5±0.7 3.5±0.7 0±0 2.5±0 0±0
9.4 0±0 0±0 0±0 0±0 0±0 0±0
Fluconazole
0±0 0±0 0±0 0±0 0±0 0±0
(100 mg/mL)

Figure 2: Molecular characterization of the endophyte as Sordarimycetes sp

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 182
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

Sequencing: The result of the molecular characterization (Table 5) revealed that the endophytic fungus has a
DNA sequence as same to Sordariomycetes.

Table 5: Molecular identification of endophytic fungus isolated from the leaf of J. carnea
DNA Name of GenBank
Sequence fungus accession number

>UG1_ITS-1_C06_09
AACCCCATGTTGAACTTATCTCTTTGTTGCCTCGGCGCAAGCTACCC
GGGACCTCGTGCCCCGGGCGGCCCGCCGGCGGACAAACCAAACTC
TGTTATCTTCGTTGATTATCTGAGTGTCTTATTTAATAAGTCAAAACT
TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCG Sordariomycetes KP306960.1
AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT spp.
CTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGT
TCGAGCGTCATTTCAACCCCTAAGCACAGCTTATTGTTGGGAATCCA
CGCCTGTGGTTCCTCAAAGACATTGGCGGAGTGGCAGTAGTCCTCT
GAGCGTAGTAATTCTTTATCTCGCTTTTGTTAGGTGCTGCCCCCCCG
GCCGTAAAACCCCCAATTTTTTCTGGTTGACCTCGGATCAGGTAGG
AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Discussion
The findings of the current study provide compelling insights into the antifungal resistance patterns of Candida
albicans and the potential of endophytic fungi from Justicia carnea as alternative therapeutic agents. The
susceptibility profile revealed a concerning resistance of Candida albicans isolates to two commonly used
antifungal agents-fluconazole and miconazole. This aligns with global reports of increasing antifungal
resistance [19], particularly among immunocompromised patients and those with recurrent candidiasis. The
lack of activity observed in most isolates suggests possible overuse or misuse of these agents in clinical
settings, leading to selective pressure and resistance development. These findings underscore the urgent need
for alternative antifungal strategies and routine susceptibility testing to guide effective treatment. The
successful isolation of endophytic fungi from the leaf blade of Justicia carnea, as evidenced by distinct
colonial features and metabolite yield, highlights the plant’s potential as a reservoir of bioactive compounds.
Endophytes are known to produce secondary metabolites that mimic or enhance the host plant’s
pharmacological properties.
The antifungal assay demonstrated that the crude extract from the isolated endophyte exhibited significant
fungicidal activity against most Candida albicans isolates, with efficacy dependent on concentration. This
dose-dependent response suggests the presence of potent bioactive compounds within the extract. The ability
of the extract to inhibit resistant strains further supports its therapeutic potential and warrants further
purification and characterization of the active constituents. Molecular sequencing revealed that the isolated
endophytic fungus shares a DNA sequence with members of the class Sordariomycetes. Sordariomycetes are
one of the largest classes of ascomycota that comprises a highly diverse range of fungi. They include many
important pathogens, as well as saprobes, endophytes, epiphytes, coprophilous and fungicolous, lichenized
taxa. They are found in terrestrial, marine and freshwater habitats globally. They are commonly isolated as
endophytes from various plants [20], and known for their rich biosynthetic capabilities, including the
production of antimicrobial and antifungal compounds. The identification of Sordariomycetes as the source
organism strengthens the hypothesis that the observed antifungal activity is linked to its metabolic profile.

Conclusion: This study highlights the resistance of Candida albicans to standard antifungals, the promising
activity of Justicia carnea-derived endophytes, and suggests a valuable avenue for developing novel
antifungal agents.

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 183
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

References

1. Gow NAR, Yadav B. Microbe profile: Candida albicans: A shape-changing, opportunistic pathogenic fungus
of humans. Microbiology. 2017; 163: 1145-1147. doi: 10.1099/mic.0.000499
2. Anejionu MG, Nweze EI, Dibua EU, Esimone CO. Efficacy of two commonly used antifungal herbs in Nigeria
against clinical isolates of fungi. Microbiology Journal. 2012; 1-16. doi: 10.3923/mj.2012.70.85
3. Kabir MA, Hussain MA, Ahmad Z. Candida albicans: A model organism for studying fungal pathogens. ISRN
Microbiology. 2012; 5: 538694. doi: 10.5402/2012/538694
4. Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Virulence. 2013; 4(2): 119-128.
doi: 10.4161/viru.22913
5. Matthaiou DK, Christodoulopoulou T, Dimopoulos G. How to treat fungal infections in ICU patients. BMC
Infectious Diseases. 2015; 15: 205. doi: 10.1186/s12879-015-0934-8
6. Pfaller MA, Andes DR, Diekema DJ, Horn DL, Reboli AC, Rotstein C, et al. Epidemiology and outcomes of
invasive candidiasis due to non-albicans species of Candida in 2,496 patients: Data from the prospective
antifungal therapy (PATH) registry 2004-2008. PLoS One. 2014; 9(7): e101510. doi: 10.1371/journal.pone.
0101510
7. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner L, et al. Clinical practice
guideline for the management of candidiasis: 2016 update by the Infectious disease Society of America. Clinical
Infectious Diseases. 2016; 62(4): e1-50. doi: 10.1093/cid/civ933
8. Hoque M. Toenail fungal infection: A case report. Mediterranean Journal of Pharmacy and Pharmaceutical
Sciences. 2023; 3(4): 80-82. doi: 10.5281/zenodo.10373051
9. Prasad R, Nair R, Banerjee A. Multidrug transporters of Candida species in clinical azole resistance. Fungal
Genetics and Biology. 2019; 132: 103252. doi: 10.1016/j.fgb.2019.103252
10. Bhattacharya S, Sae-Tia S, Fries BC. Candidiasis and mechanisms of antifungal resistance. Antibiotics. 2020;
9(6): 312. doi: 10.3390/antibiotics9060312
11. El Magrahi HS, Ben Ashur AM, Agha SM, Khaleel SA, Mousa AM, Atia AE, Abuagela MO, et al. Evaluation
of the antifungal activity of Miswak (Salvadora persica) and toothpaste against oral cavity candida species.
Mediterranean Journal of Pharmacy and Pharmaceutical Sciences. 2023; 3(1): 70-76. doi: 0.5281/zenodo.
7771715
12. Cheesbrough M. District laboratory practice in tropical countries. 2009; 2nd Ed., Cambridge University Press.
doi: 10.1017/CBO9780511543470
13. Okezie UM, Eze PM, Okoye FBC, Ikegbunam MN, Ugwu MC, Esimone CO. Secondary metabolites from an
endophytic fungus of Vernonia amygdalina. African Journal of Pharmaceutical and Research and Development.
2017; 9(1): 24-26. doi: Nil.
14. Moya-Salazar J, Rojas R. Comparative study for identification of Candida albicans with germ tube test in
human serum and plasma. Clinical Microbiology and Infectious Diseases. 2018; 3(3): 1-4. doi: 10.15761/CMID.
1000143
15. Anejionu MGU, Oli AN, Ezeudu CE, Ezejiofor OI, Ezeogu J, Attama AA, Okore VC. Methicillin-resistant
Staphylococcus aureus may also be resistant to clindamycin and vancomycin. Journal of Biosciences and
Medicines. 2022; 10: 1-13. doi: 10.4236/jbm.2022.108001
16. Okezie UM, Obi MC, Morikwe UC, Ebenebe IN, Nwaneri MGU. Antimicrobial and antioxidant potentials of
crude extracts of culturally dissimilar endophytic fungi. GSC Biological and Pharmaceutical Sciences. 2023;
22(02): 187-195. doi: 10.30574/gscbps.2023.22.2.0475
17. Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, et al. Morphological
approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere.
2020; 11(1): 2678-2754. doi: 10.5943/mycosphere/11/1/20
18. Ebenebe IN, Nedum CH, Okezie UM, Egbuna NR, Obasi CC, Nwaneri MGU. Comparative assessment of
Solanum melongena (Eggplant) against multi-drug-resistant Staphylococcus aureus and Pseudomonas
aeruginosa. Mediterranean Journal of Pharmacy and Pharmaceutical Sciences. 2024; 4(4): 33-40. doi: 10.5281/
zenodo.14176439
19. Maiken, TGR, Wiederhold NP, Vallor AC, Villareal NC, Lewis JS, Patterson TF. Development of caspofungin
resistance following prolonged therapy for invasive candidiasis secondary to Candida glabrata infection.
Antimicrobial Agents and Chemotherapy. 2008; 52: 3783-3785. doi: 10.1128/AAC.00473-08
20. Kumar V, Soni R, Jain L, Dash B, Goel R. Endophytic fungi: Recent advances in identification and explorations.
In: Advances in Endophytic Fungal Research; Springer: Berlin/Heidelberg, Germany. 2019; 267-281. doi:
10.1007/978-3-030-03589-1_13

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 184
Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly
Medical Research Mediterr J Med Res

Acknowledgments: The authors are thankful to the Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University Awka,
Anambra State, Nigeria.
Author contribution: MGUN conceptualized and designed the study. Data collection was done by LNU. Data analysis was
done by MGUN & LNU while writing, editing, and proofreading was done by MGUN & UAU. All the authors read and
approved the manuscript.
Conflict of interest: The authors declare the absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Ethical issues: The authors completely observed ethical issues including plagiarism, informed consent, data fabrication or
falsification, and double publication or submission.
Data availability statement: The raw data that support the findings of this article are available from the corresponding author
upon reasonable request.
Author declarations: The authors confirm that they have followed all relevant ethical guidelines and obtained any necessary
IRB and/or ethics committee approvals.

Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 185