Breeding Science 59: 277–283 (2009)

Detection and characterization of caffeine-less tea plants originated from

interspecific hybridization

Akiko Ogino*1), Junichi Tanaka1), Fumiya Taniguchi1), Masayuki P. Yamamoto2) and Kyoji Yamada2)
1) National Institute of Vegetable and Tea Science, 87 Seto, Makurazaki, Kagoshima 898-0087, Japan
2) Department of Life, Information and System Sciences, Graduate School of Science and Engineering, University of Toyama, 3190
Gofuku, Toyama, Toyama 930-8555, Japan

Two tea plants containing little caffeine (caffeine-less) were found in a population derived from natural cross-
ings of an interspecific hybrid ‘Cha Chuukanbohon Nou 6’ (Camellia taliensis × C. sinensis). Two caffeine-
less plants showed low caffeine content and rather high theobromine, which is a precursor of caffeine,
whereas all tested tea (C. sinensis) cultivars including ‘Cha Chuukanbohon Nou 6’ were observed high caffeine/
low theobromine contents. Component analysis by HPLC showed that ‘Taliensis-akame’ (C. taliensis), which
is the seed parent of ‘Cha Chuukanbohon Nou 6’, showed low caffeine content and rather high theobromine
and may be a caffeine-less character donor. Pedigree analysis using SSR markers suggested that parent-
offspring relationship was found between tea plants related to caffeine-less tea breeding lines. Therefore,
it is considered that caffeine-less character of caffeine-less plants could be inherited recessively from
‘Taliensis-akame’ via ‘Cha Chuukanbohon Nou 6’. Preliminary genetic analysis using 33 progenies of ‘Cha
Chuukanbohon Nou 6’ suggested the possibility that the caffeine-less character might be controlled by one
recessive locus. Caffeine-less tea plants found in this study, will be efficiently used for genetic resources to
introgress caffeine-less traits to tea cultivars in breeding programs.

Key Words: tea, caffeine, interspecific crossing, genetic resources, Camellia sinensis, Camellia taliensis,
caffeine-less.

Introduction methods already exist to remove caffeine (Nagaya and

Iwahashi 2005, Maeda-Yamamoto et al. 2007), but the re-
Caffeine is an important ingredient of tea as a beverage crop sulting green tea is expensive and of low quality. However,
and stimulates mental activity by increasing concentration, if we can breed caffeine-less tea cultivars, there will be no in-
and reducing fatigue and drowsiness. There is a report that creased cost and loss of quality associated with the industrial
caffeine consumption may be associated with a reduced risk removal of caffeine.
for type 2 diabetes (Iso et al. 2006), but excessive intake of Genetic resources and breeding materials are required to
caffeine may cause inflammation of the digestive organ, generate new cultivars in breeding programs. Silvarolla et
as well as insomnia and arrhythmia (Chou et al. 1994, al. (2004) has found three coffee plants (Coffea arabica L.)
Nurminen et al. 1999). Side effects of caffeine are marked that contain little caffeine. These coffee plants were collect-
in children and the elderly. ed in Ethiopia and contain 0.08% dry matter weight caffeine,
Recently, healthy people have become concerned about which is much lower than the 1.18% dry matter weight of
caffeine’s side effects because they tend to drink a large caffeine in regular coffee plants. However, there are no re-
amount of green tea for its beneficial ingredients. At the ports of caffeine-less coffee plants being bred using these
same time, awareness of the health benefits of green tea has breeding materials. Similarly, there are no reports of domes-
increased, because of increasing reports about its functional ticated tea plants that contain little caffeine, whereas some
ingredients, such as methylate catechins, which are benefi- wild relatives (C. irrawadiensis P.K. Barua, C. ptilophylla
cial against allergies. It was reported that a green tea cultivar chang) that contain little caffeine have been reported
‘Benifuuki’ (C. sinensis (L.) O. Kuntze) has a particularly (Nagata and Sakai 1984, Ashihara et al. 1998).
high content of methylate catechins (Maeda-Yamamoto et New breeding materials have begun to be produced for
al. 2001). The caffeine content of green tea should therefore caffeine-less plants using biotechnological methods. Previ-
be controlled to enhance its benefits to our health. Industrial ous studies have clarified that caffeine is synthesized in young
tea leaves via the caffeine biosynthesis pathway shown in
Communicated by T. Yamamoto Fig. 1. In this pathway, three methylation steps are catalyzed
Received March 11, 2009. Accepted July 24, 2009. by S-adenosyl-methionine-dependent N-methyltransferases.
*Corresponding author (e-mail: akikoogi@[Link]) It is known that a single enzyme catalyzes the second and
 278 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

Fig. 1. Caffeine biosynthesis pathway. SAM: S-adenosyl-methionine, SAH: S-adenosyl-homocysteine

third methylation steps (Kato et al. 1999), and that coffee Materials and Methods
plants have an additional minor pathway (Ogawa et al.
2001). Enzymes that participate in this pathway have been Plant materials
identified (Kato et al. 2000, Uefiji et al. 2003). A transgenic A total of seven plant materials including two tea culti-
system has been developed in coffee plants (Hatanaka et al. vars (Camellia sinensis) ‘Yabukita’ and ‘Okumusashi’
1999) and caffeine-less coffee plants have been bred using (Matsumoto et al. 1962), a hybrid tea cultivar (C. taliensis ×
this technique (Ogita et al. 2003). On the other hand, there C. Sinensis) ‘Cha Chuukanbohon Nou 6’ (Ogino et al.
has been little success in creating transgenic tea plants, and 2005), three tea breeding lines ‘Makura F1-95180’,
there is no stable transgenic system for tea. ‘CafLess1’ and ‘Cafless2’, and a wild relative of tea
In this study, two caffeine-less plants were detected in ‘Taliensis-akame’ (C. taliensis) were used for the compo-
the progeny population of an interspecific hybrid ‘Cha nent and SSR analysis.
Chuukanbohon Nou 6’ (C. taliensis × C. sinensis). Then, ‘Yabukita’ is the leading tea cultivar of Japan, and it is
the caffeine-less character was characterized by analyzing cultivated in about 75% of the country’s tea fields. It was
contents of caffeine and its precursor theobromine. SSR anal- used here as a standard tea plant for the component analysis.
ysis was conducted to confirm the pedigree of two caffeine- ‘Taliensis-akame’ naturally grown in Yunnan province in
less plants, ‘Cha Chuukanbohon Nou 6’ and ‘Taliensis- China can be crossed with C. sinensis. It was registered that
akame’ (C. taliensis), in order to reveal the origin of caffeine- ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ were
less character. In preliminary genetic analysis, mode of the derived from interspecific crossings of ‘Taliensis-akame’
caffeine-less character inheritance could be suggested. The and ‘Okumusashi’. ‘CafLess1’ and ‘CafLess2’ were ob-
application of caffeine-less genetic resources identified in tained from a natural cross of ‘Cha Chuukanbohon Nou 6’.
this study was discussed. A sib-crossing population between‘Cha Chuukanbohon
Nou 6’ and ‘Makura F1-95180’ was created during 2005–
2008. Sixty-two seedlings were obtained, and 29 of which
 Detection and characterization of caffeine-less tea plants 279

Table 1. HPLC gradient condition for component composition analysis

Mobile phase
Time
A B
0.0 99 1
10.0 99 1
15.0 94 6
40.0 81 19
40.1 10 90
47.0 10 90
47.1 99 1

added to 50 mg powdered tea samples and stirred gently. The

Fig. 2. Pedigree chart of a caffeine-less plant. Double lines mean samples were left for one hour at room temperature. Then,
crossing. Dashed double lines indicate that the registered parent is false. they were filtered with filter paper (qualitative filter paper
No. 2: Advantec) and a disposable membrane filter unit
(Dismic-13CP: Advantec) before analysis. High-performance
died during growth. Thirty-three hybrid plants were estab- liquid chromatography (HPLC) for component analysis was
lished for component analysis and preliminary genetic anal- performed by using Crestpak C18T (JASCO) as the ODS col-
ysis. A pedigree chart of the materials used in this study umn at 40°C. The flow rate of a mobile phase was 1 ml/min.
except Yabukita is shown in Fig. 2. The composition of the mobile phase A was 0.1% phospho-
ric acid, 0.1% acetonitrile and 5% N,N-dimethylformamide
Sample preparation for the component analysis in distilled water and the composition of the mobile phase
First flush young shoots of tea cultivars and breeding B was 100% acetonitrile. The gradient condition is shown in
lines were harvested in a field at the National Institute of Table 1. Caffeine and theobromine peaks were identified
Vegetables and Tea Science (Makurazaki, Japan). 30 g new with a standard sample (06710-91, 336-05; Nacalai Tesque).
shoots (approximately 60 shoots) plucked from a plant as a
sample except sib-crossing population. Only one or two Simple sequence repeat (SSR) analysis
shoots were used for test in the case of individuals of sib- DNA was extracted from leaves using diatomaceous
crossing population, because they have only 2–3 shoots. The earth and a spin filter (Tanaka and Ikeda 2002). A total of 16
harvested new shoots were steamed and dried immediately. SSR markers shown in Table 2 were used in this study. SSR-
All the dried samples were ground to a fine powder with grin- PCR amplification was carried out in a 10 μl solution con-
der mill (CSM-F1: Shizuoka Seiki) or mortar before analysis. taining 0.5 U AmpliTaq Gold DNA Polymerase (Applied
Caffeine and theobromine in green tea shoots were ex- Biosystems), 1xGold Buffer, 0.8 mM dNTP mix, 2.5 mM
tracted by the method described by Horie et al. (2002). A MgCl2, 0.01% formamide, 1 pmol forward primer labeled
mixture of 5 ml ethanol and 5 ml of 1% phosphoric acid was with fluorecent chemical Fam, 1 pmol reverse primer, and

Table 2. Primer information of SSR markers

marker repeat motif a forward primer (5′ to 3′) reverse primer (5′ to 3′) Accession No.
MSE0022 (tc)19, (ta)9, (ac)5 cctgcagtgtagaaaagccccaat cgatctgggagcttcttggagata AB361048
MSE0023 (tc)13, (tc)7, (ct)3, (ta)5 tgaaacaaccacctcccttgatct agcagcgaagaaggattcattacg AB485966
MSE0026 (ac)3, (ag)7, (ac)4, (ag)3, (ag)6, (tc)3 atcaccaaaggaaacccctactgg cgcaggtggatctggagaaaatac AB461371
MSE0030 (tc)4, (ca)3, (tc)5, (tc)11 ttccaaaaccctagtttcactcca acgctctgtatcggtgaaggctac AB461369
MSE0035 (tc)13, (ag)4, (ag)5 caccttcaatcttccattgacgc cacaaaaaccccaaaataccctcc AB461372
MSE0037 (ca)3, (tc)12, (ag)4, (gaa)3 tatacccatttgccttgcttggtc gaagcaaatttgggaaatcagtgc AB485967
MSE0039 (ag)21 ccattctgctgcaattacacatcc gattttggtaagcggctcattgtc AB485968
MSE0040 (tc)18, (ctt)3 tctccgacgagtccagttcctaac tttgtacatttgcagaggcagagc AB485969
MSE0045 (ag)14, (ga)3, (ag)4 ttggcgataacttcgagacacaaa ctccctccctcccttttaatggtt AB461368
MSE0047 (tc)13, (tc)4, (tc)3 tgatcatctctaaacccctaaaaccc tgatgttggaatggttgaaggaga AB485970
MSE0100 (tc)15 ttctttccgtgtacatacaccccc gaattgttggaggccgtagaattg AB461370
MSE0107 (tc)8, (ca)3, (cct)3 tctctctactcctgcgcaatctca tcaaagatgttgctctcgtcaacc AB485971
MSE0113 (tc)14 taccttctgcaactccagcaatcc tgagattgaccatctttcatcgga AB485972
MSE0119 (tg)3, (ag)10 gcccgaagagatgttcaagtttgt tttccatttccacctacttcccaa AB485973
MSE0121 (ag)13 ccgctcgctaactacgactctctc cggcaagtatgatttttccaggag AB485974
MSE0149 (tc)12 caaaccagaattaccagctcatatcc tgggtatttggagacagcaacaga AB485975
a Commas indicate gap between the two motifs.
 280 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

0.2–0.5 ng template DNA. PCR conditions were initial de-

naturation at 94°C for 5 min; 14 cycles at 94°C for 30 sec,
62–55°C (decrease of 0.5°C for every cycle) for 30 sec, 26
cycles at 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min,
and final extension at 72°C for 5 min. The PCR products
were separated and detected using 3130xl Genetic Analyzer
(Applied Biosystems). The size of the amplified bands
was determined on an internal standard DNA (GeneScane
500 LIZ, Applied Biosystems) using GeneMapper software
(Applied Biosystems).

Results

Component analysis of caffeine and detection of caffeine-

less tea plants
Component analysis of caffeine content was established
by using HPLC. In the HPLC system, caffeine and its pre-
cursor theobromine were detected as the retention times of
about 16 and 7 minutes, respectively (Fig. 3). It was ana-
lyzed the caffeine content of 213 individuals derived from a
natural crossing of ‘Cha Chuukanbohon Nou 6’. As a result,
almost all individuals contained caffeine with the range of
1.51–4.18% of dry matter weight, whereas two individuals
showed extremely low amounts of caffeine, but a high
amount of theobromine (Fig. 3 and Table 3). We defined the
tea plants containing 0.20% or less of caffeine per dry matter
weight as “caffeine-less” tea plants and designated the two
caffeine-less individuals ‘CafLess1’ and ‘CafLess2’. In
2005, ‘CafLess1’ and ‘CafLess2’ contained 0.12 and 0.13%
of dry matter weight caffeine and 3.38 and 1.81% of dry
matter weight theobromine, respectively. And this composi-
tion was observed in 2008.
Caffeine and theobromine contents were also obtained
for ‘Yabukita’, ‘Okumusashi’, ‘Cha Chuukanbohon Nou 6’,
‘Makura F1-95180’, and ‘Taliensis-akame’ in 2005 and Fig. 3. HPLC chromatograms of component analysis. A: ‘Yabukita’;
2008 (Table 3). In 2005, ‘Yabukita’ and ‘Okumusashi’ con- B: ‘CafLess1’. Peak1: Theobromine; Peak2: Caffeine.
tained 2.72 and 2.97% of dry matter weight caffeine, and
0.08 and 0% of dry matter weight theobromine, respectively. Table 3. Caffeine and theobromine contents of 7 tea plants
Hybrid cultivar from C. taliensis × C. sinensis, i.e., ‘Cha Content (% of dry matter weight)
Chuukanbohon Nou 6’ contained 1.97% of dry matter
Theobromine Caffeine
weight caffeine, and 0.15% of dry matter weight theobro- Cultivar
mine. On the other hand, ‘Taliensis-akame’ contained only 2005 2008 2005 2008
0.14% of dry matter weight caffeine and 5.07% of dry matter 1st flush 1st flush 1st flush 1st flush
weight theobromine. In 2008, these tea cultivars showed Taliensis-akame 5.07 2.81 0.14 NDa
similar compositions and ‘Makura F1-95180’ contained Okumusashi NDa 0.05 2.97 4.02
4.21% of dry matter weight caffeine, and 0.97% of dry mat- Cha Chuukanbohon Nou 6 0.15 0.13 1.97 2.19
ter weight theobromine. The caffeine and theobromine ratios Makura F1-95180 –b 0.97 –b 4.21
CafLess1 3.38 4.29 0.12 0.02
of ‘CafLess1’ and ‘CafLess2’ were similar to ‘Taliensis-
CafLess2 1.81 –b 0.13 –b
akame’ and largely different from general green tea cultivars.
Yabukita 0.08 0.00 2.72 2.60
a
Parentage test by SSR markers not detected.
b no analysis.
Pedigree relationships of ‘Taliensis-akame’, ‘Cha
Chuukanbohon Nou 6’, ‘Makura F1-95180’, ‘Okumusashi’,
‘CafLess1’ and ‘CafLess2’ were investigated by 16 single- for all 16 SSR markers, direct parent-offspring relationships
locus SSR markers (Table 4). Since ‘CafLes1’ and ‘CafLess2’ were strongly suggested for ‘Cha Chuukanbohon Nou 6’ vs.
shared one SSR alleles with ‘Cha Chuukanbohon Nou 6’ ‘CafLess1’ as well as ‘Cha Chuukanbohon Nou 6’ vs.
 Detection and characterization of caffeine-less tea plants 281

Table 4. SSR genotypes of 6 tea plants

SSR genotype (bp)
Marker Cha Chuukanbohon
Taliensis-akame Okumusashi Makura F1-95180 CafLess1 CafLess2
Nou 6
MSE0022 174/188 202/204 174/186 174/(174) a 174/186 174/186
MSE0023 194/196 188/194 194/217 194/217 194/217 194/217
MSE0026 287/(287)a 284/296 282/287 284/287 266/287 284/287
MSE0030 249/254 260/(260)a 249/260 254/260 249/254 249/254
MSE0035 231/236 223/225 214/236 214/231 214/236 214/(214)a
MSE0037 213/(213)a 219/(219)a 206/213 206/213 206/213 206/213
MSE0039 138/141 146/(146)a 138/172 141/172 138/172 138/172
MSE0040 149/158 125/147 142/149 125/149 142/149 125/149
MSE0045 222/(222)a 226/228 222/228 222/228 222/(222)a 222/(222)a
MSE0047 272/(272)a 274/280 263/272 263/272 263/272 263/272
MSE0100 255/261 241/267 255/261 255/261 255/261 261/(261)a
MSE0107 287/288 305/313 287/313 287/290 290/313 287/290
MSE0113 350/366 350/379 358/366 358/366 358/366 358/(358)a
MSE0119 86/98 86/92 86/92 86/102 86/98 86/102
MSE0121 179/(179)a 180/(180)a 179/(179)a 179/190 179/(179)a 179/190
MSE0149 209/(209)a 218/227 209/227 209/227 227/(227)a 209/227
a Numbers in parentheses indicate that is not clear whether the genotype is a homozygote or a null allele. In either case, though, the results would
not have been affected.

‘CafLess2’. The pollen parent of ‘CafLess1’ could not be

identified in this study, because no candidate parents
showed agreement with ‘CafLess1’ by SSR analysis. When
‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ are
considered as parents of ‘CafLess2’, all SSR genotypes of
‘CafLess2’ showed no discrepancy, suggesting that
‘CafLess2’ was generated by a cross of ‘Cha Chuukanbohon
Nou 6’ and ‘Makura F1-95180’.
Parent-offspring relationships were examined for
‘Taliensis-akame’ vs. ‘Cha Chuukanbohon Nou 6’ and
‘Taliensis-akame’ vs. ‘Makura F1-95180’ by 16 SSR mark-
ers. Since all 16 SSR markers showed no discrepancy for al-
lele shares for these 2 sets of cultivars, their parent-offspring
relationships were confirmed. Additionally, ‘Okumusashi’
registered as a pollen parent of ‘Cha Chuukanbohon Nou 6’
showed allele discrepancies in 11 SSRs, indicating that
‘Okumusashi’ is not the pollen parent of ‘Cha
Chuukanbohon Nou 6’.

Genetic analysis of caffeine-less trait by a sib-crossing pop- Fig. 4. Distribution of caffeine-contained individuals and caffeine-
ulation less individuals in the sib-crossing population. : ‘Taliensis-akame’,
A sib-crossing population crossed between ‘Cha : ‘Cha Chuukanbohon Nou 6’, : ‘Makura F1-95180’, : sib-
Chuukanhbohon Nou 6’ and ‘Makura F1-95180’ was used crossing population (caffeine-less), : sib-crossing population (con-
for evaluation of caffeine-less character. Thirty-three F1 tains caffeine)
plantlets were analyzed for their caffeine and theobromine
contents by HPLC analysis. Out of 33 individuals analyzed, vs. ‘Cha Chuukanbohon Nou 6’ and ‘Taliensis-akame’ vs.
9 caffeine-less (high theobromine and low caffeine) individu- ‘Makura F1-95180’, caffeine-less trait of ‘Taliensis-akame’
als were detected (Fig. 4). Nine caffeine-less individuals could be inherited to 9 caffeine-less individuals and might
contained from 0.01–0.14% in dry matter weight caffeine, be recessive inheritance. The preliminary genetic analysis
and 1.61–3.35% in dry matter weight theobromine. Since using 33 progenies of ‘Cha Chuukanbohon Nou 6’ ×
both ‘Cha Chuukanhbohon Nou 6’ and ‘Makura F1-95180’ ‘Makura F1-95180’ suggested the possibility that the
showed high caffeine (low theobromine) and parent- caffeine-less character might be controlled by one recessive
offspring relationships were confirmed for ‘Taliensis-akame’ locus (χ2 = 0.091, P < 0.05).
 282 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

Discussion between ‘Taliensis-akame’ and ‘Makura F1-95180’, be-

tween ‘Cha Chuukanbohon Nou 6’ and ‘CafLess1’, and be-
There are approximately 3,600 tea germplasms stored as ge- tween ‘Cha Chuukanbohon Nou 6’ and ‘CafLess2’. And
netic resources at the National Institute of Vegetables and there is no discrepancy about the thing that ‘CafLess2’ was
Tea Science (Makurazaki, Japan). Among them, about 2,600 generated by a cross of ‘Cha Chuukanbohon Nou 6’ and
were collected from Japan, China, Korea, India, Indonesia, ‘Makura F1-95180’. This information is very important for
Vietnam, Iran and so on. The remaining 1,000 or so are application of caffeine-less trait in tea breeding programs.
progenies of collected germplasms. Until the present study, Kato et al. (2000) cloned the caffeine synthase (S-
no caffeine-less germplasms were detected and found adenosylmethionine dependent N-methyltransferase) gene
among genetic resources, so it was thought that the caffeine- from tea which catalyzes methylation involved in the last
less character almost never appeared. In this study, two two steps in caffeine biosynthesis. Uefuji et al. (2003) iso-
caffeine-less breeding lines, ‘CafLess1’ and ‘CafLess2’, were lated three types of cDNAs (CaXMT1, CaMXMT2, and
detected in a progeny population of ‘Cha Chuukanbohon CaDXMT1) encoding S-adenosylmethionine dependent N-
Nou 6’. This is the first report of the detection of caffeine- methyltransferases from immature fruits of coffee (Coffea
less plants in progenies of cultivated tea. arabica) plants, corresponding to three methylation steps in
The two caffeine-less breeding lines contained a high caffeine biosynthesis. We found that ‘Taliensis-akame’,
amount of theobromine but little caffeine. Low caffeine trait ‘CafLess1’ and ‘CafLess2’ had low caffeine and rather high
has been observed in wild relatives of tea, C. ptilophylla theobromine. As theobromine is a precursor of caffeine, it is
(Ashihara et al. 1998) and C. irrawadiensis (Nagata and considered that methylation step from theobromine to caf-
Sakai 1984). However, there are no reports of progenies of feine is inhibited for the present caffeine-less trait. It will be
C. ptilophylla and C. irrawadiensis being bred because these interesting to investigate caffeine-less trait and structure of
wild relatives might be difficult to cross with C. sinensis. In caffeine synthase in order to identify the mechanism of in-
this study, caffeine-less trait was found in the progenies of a hibition of caffeine synthesis. It is also important to try to
different wild relative, C. taliensis. Because of the report obtain DNA markers tightly linked to caffeine-less trait by
that C. taliensis usually contains caffeine (Nagata and Sakai using information of caffeine biosynthesis genes, which will
1984), there are 3 possibilities that the caffeine content of lead to perform marker assisted selection in tea breeding
C. taliensis species might vary, ‘Taliensis-akame’ might programs.
have a different background from the previously analyzed
C. taliensis or ‘Taliensis-akame’ might mutate. In any case, Acknowledgments
‘Taliensis-akame’ is very rare germplasm and valuable
breeding material, because it contains little or no caffeine This work was supported by KAKENHI (19780009). We are
and can easily be crossed with C. sinensis. grateful to M. M. Yamamoto and A. Nesumi (National Insti-
The caffeine-less character of ‘Taliensis-akame’ did not tute of Vegetable and Tea Science) for their invaluable ad-
appear in the F1 generation but in the F2 generation (Fig. 3 vice. We also wish to thank K. Ogawa (National Institute of
and Table 3). ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1- Vegetable and Tea Science) for her technical assistance.
95180’, which were offsprings of ‘Taliensis-akame’,
showed high caffeine content. ‘CafLess1’ and ‘CafLess2’ Literature Cited
were the offsprings of ‘Cha Chuukanbohon Nou 6’ and
Ashihara, H., M. Kato and Y.C. Xing (1998) Biosynthesis and metabo-
showed caffeine-less character. Nine out of 33 progenies of
lism of purine alkaloids in leaves of Cocoa Tea (Camellia
‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ ptilophylla). J. Plant Res. 111: 599–604.
showed caffeine-less phenotypes. These results suggested Chou, T.M. and N.L. Benowitz (1994) Caffeine and coffee: effects on
that the caffeine-less character of ‘Taliensis-akame’ is reces- health and cardiovascular disease. Comp. Biochem. Physiol. 109C:
sively inherited and that ‘Cha Chuukanbohon Nou 6’ and 173–189.
‘Makura F1-95180’ would be caffeine-less heterozygotes. Hatanaka, T., Y.E. Choi and H. Sano (1999) Transgenic plants of coffee
Since genetic analysis was conducted in rather small popula- Coffea canephora from embryogenic callus via Agrobacterium
tion size, it will be necessary to evaluate caffeine-less char- tumefaciens-mediated transformation. Plant Cell Rep. 19: 106–
acter in larger progeny size, in order to reveal whether other 110.
factors will be involved in caffeine-less trait or not. Horie, H., M. Maeda-Yamamoto, T. Ujihara and K. Kohata (2002) Ex-
Recently, SSR markers have provided a more reliable traction of tea catechins for chemical analysis. Tea Res. J. 94: 60–
64.
method for parentage analysis, constructing genetic maps
Iso, H., C. Date, K. Wakai, M. Fukui and A. Tamakoshi (2006) The rela-
and evaluating genetic diversity because of the co-dominant
tionship between green tea and total caffeine intake and risk for
inheritance and abundance of alleles per locus. In this study, self-reported Type 2 diabetes among Japanese adults. Ann. Intern.
16 SSR markers showing single-locus inheritance were de- Med. 144: 554–562.
veloped from tea and were used for evaluation of pedigree. Kato, M., K. Mizuno, T. Fujimura, M. Iwama, M. Irie, A. Crozier and
SSR analysis revealed direct parent-offspring relation be- [Link] (1999) Purification and characterization of caffeine
tween ‘Taliensis-akame’ and ‘Cha Chuukanbohon Nou 6’, synthase from tea leaves. Plant Physiol. 120: 579–586.
 Detection and characterization of caffeine-less tea plants 283

Kato, M., K. Mizuno, A. Crozier, T. Fujimura and H. Ashihara (2000) Nurminen, M.L., L. Niittynen, R. Korpela and H. Vapaatalo (1999)
Caffeine synthesis gene from tea leaves. Nature 406: 956–957. Coffee, caffeine and blood pressure. Eur. J. Clin. Nutr. 53: 831–
Maeda-Yamamoto, M., M. Sano, N. Matsuda, T. Miyase, K. Kawamoto, 839.
N. Suzuki, M. Yoshimura, H. Tachibana and K. Hakamata (2001) Ogawa, M., Y. Herai, N. Koizumi, T. Kusano and H. Sano (2001) 7-
The change of epigallocatechin-3-O-(3-O-methyl) gallate content Methylxanthine methyltransferase of coffee plants. J. Biol. Chem.
in tea of different varieties, tea seasons of crop and processing 276: 8213–8218.
method. J. of the Jpn. Soc. for Food Sci. and Technol. 48: 64–68. Ogita, S., H. Uefiji, Y. Yamaguchi, N. Koizumi and H. Sano (2003) Pro-
Maeda-Yamamoto, M., H. Nagaya, T. Mitsumori, Y. Yamaguchi, ducting decaffeineated coffee plants. Nature 423: 823.
[Link], K. Ema, M. Suzuki, H. Yamauchi, F. Warashina, Y. Ogino, A., J. Tanaka, K. Yoshida, F. Taniguchi, H. Omae, A. Nesumi,
Mizukami et al. (2007) A change of chemical components and ef- [Link], T. Takyu and Y. Takeda (2005) New parental line ‘Cha
fects on anti-allergic activity in ‘Benifuuki’ green tea which was Chuukanbohon Nou 6’ for anthocyanin-rich tea. Bull. Natl. Inst.
produced with a low caffeine processing machine. Jpn. J. of Food Veg. & Tea Sci. Jpn. 4: 77–85.
Eng. 8: 109–116. Silvarolla, M.B., P. Mazzafera and L.C. Fazuoli (2004) A naturally de-
Matsumoto, T., Y. Fuchinoue, T. Yonemaru and M. Tanaka (1962) A caffeinated arabica coffee. Nature 429: 826.
newly registered tea variety ‘Oku-Musashi’ for green tea. Tea Res. Tanaka, J. and S. Ikeda (2002) The rapid and robust DNA extraction
J. 19: 6–9. method from various plant species using diatomaceous earth and a
Nagata, T. and S. Sakai (1984) Differences in caffeine, flavanols and spin filter. Breed. Sci. 52: 151–155.
amino acids contents in leaves of cultivated species of camellia. Uefuji, H., S. Ogita, Y. Yamaguchi, N. Koizumi and H. Sano (2003)
Jpn. J. Breed. 34: 459–467. Molecular cloning and functional characterization of three distinct
Nagaya, H. and S. Iwahashi (2005) Cha namaha shori souchi to cha N-Methyltransferases involved in the caffeine biosynthetic path-
namaha shori hohou (Measures and methods for processing raw tea way in coffee plants. Plant Physiol. 132: 372–380.
leaves). JP pat. P2005–185200A.