Molecular basis of inheritance

Class 12
NEET PYQ 2013-2024

NEET 2013

Qu = 1 Te diagram shows an important concept in the genetic implication of DNA. Fill in the
blanks A to C.

(a) A – Transcription, B -Translation, C – Francis Crick

(b) A – Translation, B – Extension,C – Rosalind Franklin
(c) A – Transcription, B - Replication, C – James Watson
(d) A – Translation, B - Transcription, C – Ervin Chargaff

Qu = 2 Which enzyme will be produced in a cell if there is a non-sense mutation in the

n
lac Y gene ?
(a) Transacetylase
(b) Lactose permease and transacetylase io
at
(c) β-galactosidase
(d) Lactose permease
uc

NEET 2013 (Karnataka)

ed

Qu = 3 Which of the following is not a property of the genetic code?

(a) Non-overlapping (b) Ambiguous
(c) Degeneracy (d) Universal
B
IM

Qu = 4 The figure gives an important concept in the genetic implication of DNA. Fill the
blanks A, B and C.

(a) A-Maurice Wilkins, B-Transcription, C-Translation

(b) A-James Watson, B-Replication, C-Extension
(c) A-Erwin Chargaf, B-Translation, C-Replication
(d) A-Francis Crick, B-Translation, C-Transcription

Qu = 5 In an inducible operon, the genes are

(a) usually not expressed unless a signal turns them ”on”.
(b) usually expressed unless a signal turns them “off”.
(c) never expressed
(d) always expresser.
Qu = 6 One of the most frequently used techniques in DNA finger printing is
(a) VNTR (b) SSCP
(c) SCAR (d) AFLP

NEET 2014

Qu = 7 Transformation was discovered by

(a) Meselson and Stahl (b) Hershey and Chase
(c) Grifth (d) Watson and Crick.

Qu = 8 Select the correct option.

Direction of Direction of reading of
RNA synthesis the template DNA strand
(a) 5′ – 3′ 3′ – 5′
(b) 3′ – 5′ 5′ – 3′
(c) 5′ – 3′ 5′ – 3′
(d) 3′ – 5′ 3′ – 5′

n
Qu = 9 Which one of the following is wrongly matched?

io
(a) Transcription - Writing information from DNA to tRNA.
at
(b) Translation - Using information in mRNA to make protein.
(c) Repressor protein - Binds to operator to stop enzyme synthesis.
uc

(d) Operon - Structural genes, operator and promoter.

NEET 2015
ed

Qu = 10 Which one of the following is not applicable to RNA?

(a) Heterocyclic nitrogenous bases
B

(b) Chargaf’s rule

(c) Complementary base pairing
IM

(d) 5’ phosphoryl and 3’ hydroxyl ends

Qu = 11 Identify the correct order of organisation of genetic material from largest to

smallest.
(a) Genome, chromosome, gene, nucleotide
(b) Chromosome, genome, nucleotide, gene
(c) Chromosome, gene, genome, nucleotide
(d) Genome, chromosome, nucleotide, gene

Qu = 12 Satellite DNA is important because it

(a) does not code for proteins and is same in all members of the population
(b) codes for enzymes needed for DNA replication
(c) codes for proteins needed in cell cycle
(d) shows high degree of polymorphism in population and also the same degree of
polymorphism in an individual, which is heritable from parents to children
 NEET 2015 (Cancelled)

Qu = 13 In sea urchin DNA, which is double stranded, 17% of the bases were shown to be
cytosine. The percentages of the other three bases expected to be present in this DNA are
(a) G 17%, A 33%, T 33%
(b) G 8.5%, A 50%, T 24.5%
(c) G 34%, A 24.5%, T 24.5%
(d) G 17%, A 16.5%, T 32.5%.

Qu = 14 Gene regulation governing lactose operon of [Link] that involves the lac I gene
product is
(a) negative and repressible because repressor protein prevents transcription
(b) feedback inhibition because excess of β-galactosidase can switch of transcription
(c) positive and inducible because it can be induced by lactose
(d) negative and inducible because repressor protein prevents transcription.

NEET 2016 (Phase I)

n
Qu = 15 Which one of the following is the starter codon?
(a) UAA (b) UAG
io
at
(c) AUG (d) UGA
uc

Qu = 16 A complex of ribosomes attached to a single strand of RNA is known as

(a) polypeptide (b) Okazaki fragment
(c) polysome (d) polymer.
ed

Qu = 17 Which of the following is required as inducer(s) for the expression of Lac operon?
(a) Lactose (b) Lactose and galactose
B

(c) Glucose (d) Galactose

IM

Qu = 18 Which of the following is not required for any of the techniques of DNA
fingerprinting available at present ?
(a) Restriction enzymes
(b) DNA-DNA hybridisation
(c) Polymerase chain reaction
(d) Zinc finger analysis

NEET 2016 (Phase II)

Qu = 19 Taylor conducted the experiments to prove semi conservative mode of chromosome

replication on
(a) Vinca rosea (b) Vicia faba
(c) Drosophila melanogaster (d) E. coli.
Qu = 20 A molecule that can act as a genetic material must fullfill the traits given below,
except
(a) it should be able to express itself in the form of ‘Mendelian characters’
(b) it should be able to generate its replica
(c) it should be unstable structurally and chemically
(d) it should provide the scope for slow changes that are required for evolution.

Qu = 21 The equivalent of a structural gene is

(a) muton (b) cistron
(c) operon (d) recon.

Qu = 22 Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
(a) 5S rRNA (b) 18S rRNA
(c) 23S rRNA (d) 5.8S rRNA

Qu = 23 DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA

which is called the

n
(a) template strand (b) coding strand
(c) alpha strand (d) anti-strand.

io
at
uc
ed
B
IM

Ques 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Ans a c b d a a c a a b
Ques 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.
Ans a d a d c c a d b c
Ques 21. 22. 23. 24. 25. 26. 27. 28. 29. 30.
Ans b c b
 NEET 2017 Qu - 8 Select the correct match.
Qu -1 The final proof for DNA as the genetic (a) Matthew Meselson and [Link] : Pisum sativum
(b) Alfred Hershey and Martha Chase : TMV
material came from the experiments of
(c)Alec Jeffreys : Streptococcus pneumoniae
(a) Griffith (d)Francois Jacob and Jacques Monod : Lac operon
(b) Hershey and Chase
(C) Avery, MacLeod and McCarty Qu- 9 AGGTATCGCAT is a sequence from the
(d) Hargobind Khoran coding strand of a gene. What will be the
corresponding sequence of the transcribed
Qu -2 The association of histone H1 with a mRNA?
nucleosome indicates (a) ACCUAUGCGAU (b) UGGTUTCGCAT
(a) transcription is occurring (c) AGGUAUCGCAU (d) UCCAUAGCGUA
(b) DNA replication is occurring
(c) the DNA is condensed into chromatin NEET 2019
fiber. Qu - 10 Expressed sequence tags (ESTs) refer
(d) the DNA double helix is exposed to
(a) polypeptide expression
Qu -3 Spliceosomes are not found in cells of (b) DNA polymorphism

n
(a) plants (b) fungi (c) novel DNA sequences
(c) animals (d) bacteria

io
(d) genes expressed as RNA
at
Qu - 4 If there are 999 bases in an RNA that Qu – 11 Purines found both in DNA and RNA
codes for a protein with 333 amino acids are
uc

and the base at position 901 is deleted such (a) adenine and guanine
that the length of the RNA becomes 998 (b) guanine and cytosine
bases, how many codons will be altered?
ed

(c) cytosine and thymine

(a) 1 (b) 11 (d) adenine and thymine
(c) 33 (d) 333
Qu -12 Which of the following features of
B

Qu -5 DNA replication in bacteria occurs genetic code does allow bacteria to produce
(a) during S phase
IM

human insulin by recombinant DNA

(b) with in nucleolus technology ?
(c) prior to fission (a) Genetic code is redundant
(d) just before transcription (b) Genetic code is nearly universal
(c) Genetic code is specific
NEET 2018 (d)Genetic code is not ambiguous

Qu -6 The experimental proof for Qu -13 Match the following genes of the Lac
semiconservative replication of DNA was operon with their respective products
first shown in a A. i gene (i)beta-galactosidase
(a) plant (b) bacteria B. z gene (ii)Permease
(c) fungus (d) virus C. a gene (iii)Repressor
D. y gene (iv)Transacetylase
Qu -7 All of the following are parts of an Select the correct option
operon except: A B C D A B C D
(a) (iii) (i) (ii) (iv) (b) (iii) (i) (iv) (ii)
(a) an enhancer (b) Structural gene (c) (iii) (iv) (i) (ii) (d) (i) (iii) (ii) (iv)
(c) an operator (d) a promoter
 NEET 2019 (Odisha) Qu- 20 Which of the following statement is
Qu – 14 Which scientist experimentally correct ?
proved that DNA is the sole genetic material (a) Adenine pairs with thymine through two
in bacteriophage ? H-bonds
(a) Jacob and Monod (b) Adenine pairs with thymine through one
(b) Beadle and Tautum H-bond
(c) Messelson and Stahl (c) Adenine pairs with thymine through three
(d) Hershey and Chase H-bonds
(d) Adenine does not pair with thymine
Qu – 15 From the following, identify the
correct combination of salient features of NEET 2020 (Phase II)
Genetic code;
(a) Degenerate , Non-overlapping, Non- Qu – 21 The term ‘Nuclein’ for the genetic
ambiguous material was used by
(b) Universal, Overlapping, Non-ambiguous (a) Meischer (b) Chargaff
(c) Degenerate, Overlapping, Commaless (c) Mendel (d) Franklin
(d) Universal, Ambiguous, Degenerate

n
Qu – 22 In the polynucleotide chain of DNA, a
Qu – 16 In the process of transcription in

io
nitrogenous base is linked to the -OH of :
Eukaryotes, the RNA Polymerase I transcribe (a) 3’C pentose sugar
at
(a) Precursor of mRNA, hnRNA (b) 5’C pentose sugar
(b) mRNA with additional processing (c) 1’C pentose sugar
uc

(c) tRNA, 5 srRNA and snRNAs (d) 2’C pentose sugar

(d) rRNA – 28S, 18 S and 5.8 S
Qu – 23 which is the basis of genetic
ed

NEET 2020 mapping of human genome as well as DNA

Qu – 17 The first phase of translation is finger printing ?
(a) Binding of mRNA to ribosome (a) Single Nucleotide Polymorphism
B

(b) Recognition of DNA molecule (b) Polymorphism in hnRNA sequence

(c) Aminoacylation of tRNA (c) Polymorphism in RNA sequence
IM

(d) Recognition of an anti-codon (d) Polymorphism in DNA sequence

Qu- 18 If the distance between two Qu – 24 E. Coli has only 4.6x106 base pairs
consecutive base pairs is 0.34nm and the and completes the process of replication
total number of base pairs of a DNA double within 18 minutes ; then the average rate of
helix in a typical mammalian cell is 6.6×10⁹bp polymerisation is approximately -
then the length of the DNA is approximately
(a) 2.0 meters (b) 2.2 meters (a) 3000 base pairs/second
(c) 2.5 meters (d) 2.7 meters (b) 4000 base pairs/second
(c) 1000 base pairs/second
Qu – 19 Name the enzyme that facilitates (d) 2000 base pairs/second
opening of DNA helix during transcription.
(a) DNA ligase (b) DNA helicase
(c) DNA polymerase (d) RNA polymerase
 NEET 2021 Qu = 29 Which one of the following
statements about Histones is wrong?
Qu = 25 If Adenine makes 30% of the DNA (a) Histones are organized to form a unit of 8
molecule, what will be the percentage of molecules.
Thymine, Guanine and Cytosine in it ? (b) The pH of histones is slightly acidic.
(a) T : 20 ; G : 30 ; C : 20 (c) Histones are rich in amino acids - Lysine
(b) T : 20 ; G : 20 ; C : 30 and Arginine.
(c) T : 30 ; G : 20 ; C : 20 (d) Histones carry positive charge in the side
(d) T : 20 ; G : 25 ; C : 25 chain.

Qu = 26 Which is the "Only enzyme" that has Qu = 30 Complete the flow chart on central
"Capability" to catalyse Initiation, Elongation dogma
and Termination in the process of
transcription in prokaryotes ?
(a) DNA dependent DNA polymerase

n
(b) DNA dependent RNA polymerase (a) = (a)-Replication; (b)-Transcription; (c)-
(c) DNA Ligase
(d) DNase
io
Transduction; (d)-Protein
(b) = (a)-Translation; (b)-Replication; (c)-
at
Transcription; (d)-Transduction
Qu = 27 Which of the following RNAs is not (c) = (a)-Replication; (b)-Transcription; (c)-
uc

required for the synthesis of protein ? Translation; (d)-Protein

(a) mRNA (b) tRNA (d) = (a)-Transduction; (b)-Translation; (c)-
(c) rRNA (d) siRNA
ed

Replication; (d)-Protein

Qu = 28 Statement I : The condon 'AUG' Qu = 31 Identify the correct statement.

codes for methionine and phenylalanine. (a) In capping, methyl guanosine
B

Statement II : 'AAA' and 'AAG' both codons triphosphate is added to the 3' end of
code for the amino acid lysine.
IM

hnRNA.
In the light of the above statements, choose (b) RNA polymerase binds with Rho factor to
the correct answer from the options given terminate the process of transcription in
below. bacteria.
(a) Both statement I and Statement II are (c) The coding strand in a transcription unit is
true. copied to an mRNA.
(b) Both Statement I and Statement II are (d) Split gene arrangement is characteristic of
false prokaryotes.
(c) Statement I is correct but Statement II is
false Qu = 32 DNA fingerprinting involves
(d) Statement I is incorrect but Statement II is identifying differences in some specific
true regions in DNA sequence, called as :
(a) Satellite DNA
(b) Repetitive DNA
(c) Single nucleotides
(d) Polymorphic DNA
Qu = 33 What is the role of RNA polymerase Qu = 37 If a geneticist uses the blind
III in the process of transcription in approach for sequencing the whole genome
eukaryotes ? of an organism, followed by assignment of
(a) Transcribes rRNAs (28S, 18S and 5.8S) function to different segments, the
(b) Transcribes tRNA, 5s rRNA and snRNA methodology adopted by him is called as:
(c) Transcribes precursor of mRNA (a) Bioinformatics
(d) Transcribes only snRNAs (b) Sequence annotation
(c) Gene mapping
NEET 2022 (d) Expressed sequence tags

Qu = 34 DNA polymorphism forms the basis Qu = 38 In an [Link] strain i gene gets

of: mutated and its product can not bind the
(a) Translation inducer molecule. If growth medium is
(b) Genetic mapping provided with lactose, what will be the
(c) DNA finger printing outcome?

n
(d) Both genetic mapping and DNA finger (a) RNA polymerase will bind the promoter
printing

io
region
(b) Only z gene will get transcribed
at
Qu = 35 The process of translation of mRNA (c) z, y, a genes will be transcribed
to proteins begins as soon as: (d) z, y, a genes will not be translated
uc

(a) The tRNA is activated and the larger

subunit of ribosome encounters mRNA Qu = 39 If the length of a DNA molecule is 1.4
(b) The small subunit of ribosome encounters metres, what will be the approximate
ed

mRNA number of base pairs?

(c) The larger subunit of ribosome (a) 6.6 × 106 bp (b) 3.3 × 109 bp
9
encounters mRNA (c) 6.6 × 10 bp (d) 3.3 × 106 bp
B

(d) Both the subunits join together to bind

with mRNA Qu = 40 Ten [Link] with 15N- dsDNA are
IM

incubated in medium containing 14N

Qu = 36 Read the following statements and nucleotide. After 60 minutes, how many [Link]
choose the set of correct statements cells will have DNA totally free from 15N?
A. Euchromatin is loosely packed chromatin (a) 80 cells (b) 20 cells
B. Heterochromatin is transcriptionally active (c) 40 cells (d) 60 cells
C. Histone octomer is wrapped by negatively
charged DNA in nucleosome NEET 2023
D. Histones are rich in lysine and arginine
E. A typical nucleosome contains 400 bp of Qu = 41 Expressed Sequence Tags (ESTs)
DNA helix refers to
(1) All genes that are expressed as proteins.
Choose the correct answer from the options (2) All genes whether expressed or
given below. unexpressed.
(a) A, C and E only (b) B, D and E only (3) Certain important expressed genes.
(c) A, C and D only (d) B and E only (4) All genes that are expressed as RNA.
Qu = 42 Unequivocal proof that DNA is the Qu = 46 Given below are two statements:
genetic material was first proposed by Statement I: In prokaryotes, the positively
(1) Alfred Hershey and Martha Chase charged DNA is held with some negatively
(2) Avery, Macleoid and McCarthy charged proteins in a region called nucleoid.
(3) Wilkins and Franklin Statement II: In eukaryotes, the negatively
(4) Frederick Griffith charged DNA is wrapped around the
positively charged histone octamer to form
Qu = 43 What is the role of RNA polymerase nucleosome.
III in the process of transcription in In the light of the above statements, choose
Eukaryotes? the correct answer from the options given
(1) Transcription of tRNA, 5 srRNA and snRNA below:
(2) Transcription of precursor of mRNA (1) Both Statement I and Statement II are
(3) Transcription of only snRNAs false.
(4) Transcription of rRNAs (28S, 18S and 5.8S) (2) Statement I is correct but Statement II is
false.
Qu = 44 How many different proteins does (3) Statement I is incorrect but Statement II is

n
the ribosome consist of? true.
(1) 60
(3) 20
(2) 40
(4) 80
io
(4) Both Statement I and Statement II are
true.
at
Qu = 45 Given below are two statements: Qu = 47 Which of the following is not a
uc

Statement I: RNA mutates at a faster rate. cloning vector?

Statement II: Viruses having RNA genome (1) YAC (2) pBR322
and shorter life span mutate and evolve (3) Probe (4) BAC
ed

faster.
Qu = 48 Match List I with List II.
In the light of the above statements, choose List I List II
B

the correct answer from the options given A. Gene ‘a’ I. β-galactosidase
below: B. Gene ‘y’ II. Transacetylase
IM

(1) Both Statement I and Statement II are C. Gene ‘i’ III. Permease
false. D. Gene ‘z’ IV. Repressor protein
(2) Statement I is true but Statement II is
false. Choose the correct answer from the options
(3) Statement I is false but Statement II is given below:
true. (1) A-II, B-III, C-IV, D-I
(4) Both Statement I and Statement II are (2) A-III, B-IV, C-I, D-II
true. (3) A-III, B-I, C-IV, D-II
(4) A-II, B-I, C-IV, D-III
 Qu = 53 Which scientist conducted an
Qu = 49 Which one of the following is the experiment with 32P and 35S labelled phages
sequence on corresponding coding strand, if for demonstrating that DNA is the genetic
the sequence on mRNA formed is as follows material ?
5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’? (1) F. Griffith
(2) O.T. Avery, C.M. MacLeod and M. McCarty
(1) 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’ (3) James D. Watson and F.H.C. Crick
(2) 5’ ATCGATCGATCGATCGATCGATCGATCG 3’ (4) A.D. Hershey and M.J. Chase
(3) 3’ ATCGATCGATCGATCGATCGATCGATCG 5’
(4) 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’ Qu = 54 Given below are two statements:
Statement I: RNA being unstable, mutate at
NEET 2023 (Manipur) a faster rate.
Statement II: RNA can directly code for
Qu = 50 Name the component that binds to synthesis of proteins, hence can easily
the operator region of an operon and express the characters.
prevents RNA polymerase from transcribing

n
the operon. In the light of the above statements, choose
(1) Repressor protein
(2) Inducer below:
io
the correct answer from the options given
at
(3) Promotor (1) Both Statement I and Statement II are true
(4) Regulator protein (2) Both Statement I and Statement II are false
uc

(3) Statement I is correct but Statement II is false

Qu = 51The last chromosome sequenced in (4) Statement I is incorrect but Statement II is true
Human Genome Project was :
ed

(1) Chromosome 22 Qu = 55 Which one of the following acts as an

(2) Chromosome 14 inducer for lac operon?
(3) Chromosome 6 (1) Glucose
B

(4) Chromosome 1 (2) Galactose

(3) Sucrose
IM

Qu = 52 Given below are two statements : (4) Lactose

Statement I : The process of copying genetic
information from one strand of the DNA into Qu = 56 The salient features of genetic code
RNA is termed as transcription. are :
Statement II : A transcription unit in DNA is (A) The code is palindromic
defined primarily by the three regions in the (B) UGA act as initiator codon
DNA, i.e., a promotor, the structural gene and (C) The code is unambiguous and specific
a terminator. (D) The code is nearly universal

In the light of the above statements, choose Choose the most appropriate answer from
the correct answer from the options given the options given below :
below : (1) (A) and (B) only
(1) Both Statement I and Statement II are true (2) (C) and (D) only
(2) Both Statement I and Statement II are false (3) (A) and (D) only
(3) Statement I is true but Statement II is false (4) (B) and (C) only
(4) Statement I is false but Statement II is true
 NEET 2024
Qu = 59 Which of the following statement is
Qu = 57 A transcription unit in DNA is defined correct regarding the process of replication
primarily by the three regions in DNA and in [Link]?
these are with respect to upstream and down (1) The DNA dependent DNA polymerase
stream end; catalyses polymerization in one direction that
(1) Repressor, Operator gene, Structural gene is 3’ → 5’
(2) Structural gene, Transposons, Operator (2) The DNA dependent RNA polymerase
gene catalyses polymerization in one direction,
(3) Inducer, Repressor, Structural gene that is 5’ → 3’
(4) Promotor, Structural gene, Terminator (3) The DNA dependent DNA polymerase
catalyses polymerization in 5’ → 3’ as well as
Qu = 58 The lactose present in the growth 3’ → 5’ direction
medium of bacteria is transported to the cell (4) The DNA dependent DNA polymerase
by the action of catalyses polymerization in 5’ → 3’ direction
(1) Beta-galactosidase

n
(2) Acetylase Qu = 60 Which one is the correct product of
(3) Permease
(4) Polymerase
io
DNA dependent RNA polymerase to the given
template?
at
3’TACATGGCAAATATCCATTCA5’
uc

(1) 5’AUGUACCGUUUAUAGGUAAGU3’
(2) 5’AUGUAAAGUUUAUAGGUAAGU3’
(3) 5’AUGUACCGUUUAUAGGGAAGU3’
ed

(4) 5’ATGTACCGTTTATAGGTAAGT3’
B
IM

Qu = 61 Match List I with List II

List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

(1) A-III, B-II, C-I, D-IV (2) A-III, B-IV, C-I, D-II
(3) A-II, B-III, C-IV, D-I (4) A-IV, B-I, C-II, D-III
Qu = 62 Match List I with List II:
List I List II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below :

(1) A-II, B-IV, C-I, D-III (2) A-III, B-II, C-IV, D-I
(3) A-III, B-IV, C-I, D-II (4) A-IV, B-III, C-I, D-II

n
Quest 1 2 3 4 5 io6 7 8 9 10
at
Ans b c d c c b a d c d
uc

Quest 11 12 13 14 15 16 17 18 19 20
Ans a b b d a d c b d a
ed

Quest 21 22 23 24 25 26 27 28 29 30
Ans a c d d c b d d b c
Quest 31 32 33 34 35 36 37 38 39 40
B

Ans b b b d b c b d b d
IM

Quest 41 42 43 44 45 46 47 48 49 50
Ans 4 1 1 4 4 3 3 1 2 1
Quest 51 52 53 54 55 56 57 58 59 60
Ans 4 1 4 1 4 2 4 3 4 1
Quest 61 62 63 64 65 66 67 68 69 70
Ans 2 4
IM
B
ed
uc
at
io
n